Incidental Mutation 'R0437:Vwf'
ID 39068
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 038638-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R0437 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125543281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 174 (D174V)
Ref Sequence ENSEMBL: ENSMUSP00000107872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100941] [ENSMUST00000112253] [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000100941
AA Change: D189V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098502
Gene: ENSMUSG00000001930
AA Change: D189V

DomainStartEndE-ValueType
VWD 38 196 3.43e-35 SMART
C8 236 310 1.11e-21 SMART
Pfam:TIL 313 366 2.8e-15 PFAM
Blast:VWC 368 404 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112253
AA Change: D174V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107872
Gene: ENSMUSG00000001930
AA Change: D174V

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 2.7e-15 PFAM
Blast:VWC 353 389 6e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112254
AA Change: D171V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: D171V

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Meta Mutation Damage Score 0.8298 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G A 13: 119,606,631 (GRCm39) R291K probably benign Het
Abca2 T C 2: 25,332,857 (GRCm39) S1519P probably damaging Het
Abcb11 G A 2: 69,087,639 (GRCm39) A1042V probably damaging Het
Abcc10 A T 17: 46,623,845 (GRCm39) probably null Het
Abcc10 G T 17: 46,623,846 (GRCm39) probably benign Het
Alkbh3 A C 2: 93,811,914 (GRCm39) L240V probably damaging Het
Apol10b T C 15: 77,469,608 (GRCm39) S190G probably benign Het
Atp1a3 C A 7: 24,698,392 (GRCm39) C135F probably benign Het
Atp4a C G 7: 30,419,526 (GRCm39) R659G probably benign Het
Bicra A G 7: 15,722,687 (GRCm39) S277P possibly damaging Het
Bltp1 A T 3: 37,043,953 (GRCm39) H2820L possibly damaging Het
Bmp8a T C 4: 123,210,690 (GRCm39) E275G probably benign Het
Ccdc102a T C 8: 95,640,054 (GRCm39) E80G probably damaging Het
Cdh23 T C 10: 60,246,576 (GRCm39) D954G probably damaging Het
Chrm4 A G 2: 91,758,788 (GRCm39) T399A possibly damaging Het
Clcn3 A G 8: 61,387,571 (GRCm39) V199A possibly damaging Het
Crlf1 T C 8: 70,952,164 (GRCm39) probably null Het
Crx G T 7: 15,605,071 (GRCm39) S57* probably null Het
Cstpp1 A G 2: 91,252,298 (GRCm39) L21P probably damaging Het
Cyp4f16 A G 17: 32,756,072 (GRCm39) I34V possibly damaging Het
Daxx T C 17: 34,132,598 (GRCm39) V576A probably benign Het
Ddx17 C T 15: 79,421,672 (GRCm39) R351H probably damaging Het
Dhx38 T C 8: 110,285,261 (GRCm39) probably benign Het
Dnd1 T C 18: 36,897,552 (GRCm39) probably benign Het
Dync1i2 A T 2: 71,058,169 (GRCm39) probably null Het
E2f6 T C 12: 16,866,446 (GRCm39) S52P probably benign Het
Epb41l4a A G 18: 34,013,326 (GRCm39) F116S probably damaging Het
Ext1 T C 15: 52,969,502 (GRCm39) N362S probably damaging Het
Fam227a C A 15: 79,528,189 (GRCm39) K79N possibly damaging Het
Fam228a T A 12: 4,782,759 (GRCm39) L111F probably damaging Het
Fat2 T C 11: 55,173,625 (GRCm39) T2363A probably benign Het
Fat3 A T 9: 15,908,228 (GRCm39) N2591K probably damaging Het
Frem2 A G 3: 53,560,436 (GRCm39) M1357T possibly damaging Het
Frmd4b A T 6: 97,400,424 (GRCm39) V29D probably damaging Het
G930045G22Rik A G 6: 50,823,918 (GRCm39) noncoding transcript Het
Galnt3 A G 2: 65,937,573 (GRCm39) S46P possibly damaging Het
Gmeb2 A G 2: 180,895,766 (GRCm39) V468A possibly damaging Het
Herc2 C T 7: 55,869,563 (GRCm39) R4271* probably null Het
Il5 C A 11: 53,614,733 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,818 (GRCm39) probably benign Het
Itga10 T C 3: 96,556,453 (GRCm39) F196S probably damaging Het
Itgb3bp T C 4: 99,670,126 (GRCm39) T138A probably damaging Het
Kcnd1 G A X: 7,690,922 (GRCm39) V281M probably benign Het
Lcp2 T C 11: 34,037,229 (GRCm39) L391P probably benign Het
Lrrc66 T C 5: 73,765,030 (GRCm39) Y671C probably benign Het
Mettl23 T C 11: 116,740,120 (GRCm39) V197A possibly damaging Het
Mmp15 C A 8: 96,097,400 (GRCm39) D456E probably benign Het
Mospd4 T C 18: 46,598,848 (GRCm39) noncoding transcript Het
Mov10l1 C A 15: 88,889,515 (GRCm39) H484N probably damaging Het
Mphosph9 T C 5: 124,453,631 (GRCm39) Q197R probably benign Het
Ms4a1 T A 19: 11,233,933 (GRCm39) probably null Het
Mybbp1a T C 11: 72,339,674 (GRCm39) V919A possibly damaging Het
Mycbpap A T 11: 94,404,338 (GRCm39) probably benign Het
Naip6 G A 13: 100,433,432 (GRCm39) S1135F possibly damaging Het
Ndufc2 T A 7: 97,049,544 (GRCm39) M50K probably benign Het
Npr2 T C 4: 43,648,082 (GRCm39) V842A probably damaging Het
Ntsr2 G T 12: 16,703,696 (GRCm39) G66W probably damaging Het
Obscn T C 11: 58,885,914 (GRCm39) probably benign Het
Optn C T 2: 5,028,926 (GRCm39) G526R probably damaging Het
Or4c11 T A 2: 88,695,229 (GRCm39) N93K probably benign Het
Or4c114 T A 2: 88,904,956 (GRCm39) I160F probably benign Het
Or6c33 T C 10: 129,853,965 (GRCm39) V245A probably damaging Het
Or6k14 G A 1: 173,927,965 (GRCm39) G314R probably benign Het
Otud4 T A 8: 80,396,626 (GRCm39) H628Q probably benign Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pex16 G T 2: 92,205,937 (GRCm39) R10L probably damaging Het
Pitpnm2 A G 5: 124,269,152 (GRCm39) probably benign Het
Pom121l2 A G 13: 22,167,375 (GRCm39) T549A possibly damaging Het
Prdm15 A T 16: 97,613,759 (GRCm39) M470K probably benign Het
Prkag2 T A 5: 25,233,503 (GRCm39) D49V possibly damaging Het
Prl3c1 A G 13: 27,383,447 (GRCm39) M38V probably benign Het
Prpf18 T A 2: 4,648,572 (GRCm39) I85F possibly damaging Het
Psg27 A G 7: 18,294,636 (GRCm39) probably benign Het
Relt A G 7: 100,497,991 (GRCm39) probably benign Het
Rskr T C 11: 78,182,362 (GRCm39) L57P probably benign Het
Serpina3b A T 12: 104,096,929 (GRCm39) N70I probably damaging Het
Slc19a3 T C 1: 83,000,286 (GRCm39) S244G probably benign Het
Slc39a5 T C 10: 128,235,716 (GRCm39) T81A possibly damaging Het
Slc7a2 G A 8: 41,357,563 (GRCm39) G277D probably damaging Het
Slc9c1 C T 16: 45,420,250 (GRCm39) probably benign Het
Slx1b A G 7: 126,291,753 (GRCm39) F104L probably benign Het
Smg6 G A 11: 74,820,527 (GRCm39) S266N probably damaging Het
Spata9 T C 13: 76,146,614 (GRCm39) V162A possibly damaging Het
Szrd1 T C 4: 140,846,055 (GRCm39) I47V probably benign Het
Tha1 G T 11: 117,759,401 (GRCm39) L363M probably benign Het
Tmc6 G A 11: 117,669,087 (GRCm39) T89I possibly damaging Het
Tmem132d C T 5: 127,866,849 (GRCm39) G684R probably damaging Het
Trim55 G A 3: 19,725,142 (GRCm39) G220S probably benign Het
Ttn A G 2: 76,600,874 (GRCm39) L18836P probably damaging Het
Ubn1 G T 16: 4,890,048 (GRCm39) probably benign Het
Ush2a T G 1: 188,643,228 (GRCm39) W4197G probably benign Het
Vmn1r189 A T 13: 22,286,231 (GRCm39) V202E probably damaging Het
Vmn1r209 T C 13: 22,990,526 (GRCm39) I55V probably benign Het
Vmn2r86 A T 10: 130,282,412 (GRCm39) C735S probably damaging Het
Zfp438 T C 18: 5,214,910 (GRCm39) N16S probably damaging Het
Zfp444 C T 7: 6,192,408 (GRCm39) T142I probably benign Het
Zfp804a A G 2: 81,884,135 (GRCm39) M1V probably null Het
Zfp936 T G 7: 42,838,734 (GRCm39) I67S probably benign Het
Zfp948 A T 17: 21,807,260 (GRCm39) N151Y unknown Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AACGCGAGGCTGGGTACTATAAGC -3'
(R):5'- GAGGTGGACTTAAATCCCTGCTGTG -3'

Sequencing Primer
(F):5'- GGTACTATAAGCTCTCCAGTGAGAC -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On 2013-05-23