Incidental Mutation 'R4558:Fam189a2'
ID397271
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission 042005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4558 (G1)
Quality Score200
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24030549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 130 (S130L)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably damaging
Transcript: ENSMUST00000096164
AA Change: S130L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: S130L

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Meta Mutation Damage Score 0.1823 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Acot11 T C 4: 106,748,366 N583S probably damaging Het
Alox12 T G 11: 70,253,063 M164L probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Bmpr2 T A 1: 59,845,692 M279K probably damaging Het
Cacna2d3 T C 14: 29,103,713 T502A possibly damaging Het
Casp12 A T 9: 5,352,742 Y188F probably damaging Het
Catsperb A G 12: 101,591,540 Y790C possibly damaging Het
Cnbd1 G T 4: 19,055,095 N110K possibly damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam227b C T 2: 126,127,043 S37N probably benign Het
Fsip2 T C 2: 82,984,953 S3677P possibly damaging Het
Gm10764 A G 10: 87,290,820 noncoding transcript Het
H2-Q6 T C 17: 35,428,315 V312A probably benign Het
Hecw1 T A 13: 14,247,605 D972V probably damaging Het
Kalrn G A 16: 33,987,208 T2597I possibly damaging Het
Kng1 C A 16: 23,077,418 probably null Het
Med13 T C 11: 86,299,054 T1010A probably damaging Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Ncapg A T 5: 45,676,644 T341S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb4 A G 18: 37,309,964 I776V probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Pramef12 T C 4: 144,395,972 M1V probably null Het
Psd4 G A 2: 24,404,794 V789M probably damaging Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Serpinb9c T A 13: 33,154,499 E139V probably benign Het
Sgsm1 G A 5: 113,258,111 probably benign Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Upf2 A G 2: 5,973,593 M423V unknown Het
Vmn1r207-ps A G 13: 22,726,411 noncoding transcript Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACTGTCTCCCGACACTAAC -3'
(R):5'- TGGACACTTTTCCCGGTGAC -3'

Sequencing Primer
(F):5'- GTCTCCCGACACTAACCTCCC -3'
(R):5'- TGCTCTGCAGCCTCCAG -3'
Posted On2016-07-05