Incidental Mutation 'R6952:Fam189a2'
ID543309
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6952 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23984718 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 307 (M307K)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096164
AA Change: M307K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: M307K

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,734 probably null Het
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGGTGTCAGTTTTCCCTAG -3'
(R):5'- AAGCACTGTGTGGCATTTCC -3'

Sequencing Primer
(F):5'- CTCTAGGTCAAGATTGGGACTTATC -3'
(R):5'- AGCTTTCCATCCCTACTGTGTGATC -3'
Posted On2018-11-28