Incidental Mutation 'R6573:Fam189a2'
ID523332
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6573 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23988502 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 211 (N211I)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably damaging
Transcript: ENSMUST00000096164
AA Change: N211I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: N211I

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cr12 A G 1: 58,666,844 F289L probably benign Het
Ceacam5 A G 7: 17,713,447 M1V probably null Het
Clstn1 A G 4: 149,643,689 T605A probably damaging Het
Cstf2t A G 19: 31,083,780 M239V probably benign Het
Dsp A T 13: 38,196,862 R1929W probably damaging Het
Edf1 G T 2: 25,561,863 R133L probably damaging Het
Efcab3 A T 11: 105,080,635 Y129F possibly damaging Het
Fbxo34 A T 14: 47,529,667 L212F possibly damaging Het
Gas2l3 C A 10: 89,422,210 probably null Het
Gfod1 C T 13: 43,200,365 S378N probably damaging Het
Gse1 T C 8: 120,567,797 S288P probably damaging Het
Gzme T A 14: 56,118,826 T72S probably benign Het
Hyal5 T C 6: 24,891,552 V455A probably damaging Het
Megf9 A T 4: 70,488,172 C252* probably null Het
Mrgprg T C 7: 143,764,596 K260E possibly damaging Het
Nmi T A 2: 51,950,069 K220M possibly damaging Het
Nutm1 A C 2: 112,251,043 probably null Het
Olfr1008 C T 2: 85,689,999 S190L probably damaging Het
Olfr694 A T 7: 106,689,463 D89E probably benign Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Perm1 C A 4: 156,218,673 A558D probably damaging Het
Pgpep1 A G 8: 70,650,615 I203T probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Prune2 G T 19: 17,121,157 G1342C probably damaging Het
Prune2 G T 19: 17,121,158 G1342V possibly damaging Het
Ros1 T A 10: 52,155,010 I512F possibly damaging Het
Slc10a5 A T 3: 10,335,050 F183L probably damaging Het
Slc13a1 T C 6: 24,137,095 R107G probably damaging Het
Spag5 C T 11: 78,314,182 Q598* probably null Het
Spata6 T A 4: 111,779,279 F256I probably damaging Het
Tnnt1 C A 7: 4,514,334 probably null Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Unc79 G A 12: 103,061,388 E413K probably damaging Het
Vmn2r104 A T 17: 20,042,225 F214L probably damaging Het
Vmn2r118 C T 17: 55,592,996 C636Y probably damaging Het
Zfat T C 15: 68,165,854 N917S probably damaging Het
Zfp317 T C 9: 19,645,254 S53P probably damaging Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGGTTATTAGGGCTGCTCATAC -3'
(R):5'- AATAAACCTTGCCCGAGATTGC -3'

Sequencing Primer
(F):5'- GGCTGCTCATACTTGCTTGTAGC -3'
(R):5'- CCCGAGATTGCTTGACATGGAAC -3'
Posted On2018-06-22