Incidental Mutation 'R5236:Pabpn1'
ID398433
Institutional Source Beutler Lab
Gene Symbol Pabpn1
Ensembl Gene ENSMUSG00000022194
Gene Namepoly(A) binding protein, nuclear 1
Synonymspoly(A) binding protein II, Pabp3
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54892500-54898169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54894942 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 145 (M145K)
Ref Sequence ENSEMBL: ENSMUSP00000112177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022808] [ENSMUST00000116476] [ENSMUST00000134077] [ENSMUST00000139985] [ENSMUST00000140691] [ENSMUST00000141446] [ENSMUST00000146271] [ENSMUST00000150975] [ENSMUST00000172557] [ENSMUST00000172695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022808
AA Change: M145K

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022808
Gene: ENSMUSG00000022194
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
low complexity region 283 295 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000116476
AA Change: M145K

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112177
Gene: ENSMUSG00000022194
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134077
AA Change: M176K

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232
AA Change: M176K

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139985
AA Change: M21K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122432
Gene: ENSMUSG00000022194
AA Change: M21K

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140691
AA Change: M49K

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115294
Gene: ENSMUSG00000022194
AA Change: M49K

DomainStartEndE-ValueType
coiled coil region 9 51 N/A INTRINSIC
RRM 73 145 4.19e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141446
AA Change: M21K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123305
Gene: ENSMUSG00000022194
AA Change: M21K

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146271
Predicted Effect probably benign
Transcript: ENSMUST00000150975
AA Change: M145K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133937
Gene: ENSMUSG00000022194
AA Change: M145K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 3.23e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172557
AA Change: M21K

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133405
Gene: ENSMUSG00000022194
AA Change: M21K

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
low complexity region 159 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172695
SMART Domains Protein: ENSMUSP00000133579
Gene: ENSMUSG00000022194

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 59 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant nuclear protein that binds with high affinity to nascent poly(A) tails. The protein is required for progressive and efficient polymerization of poly(A) tails at the 3' ends of eukaryotic transcripts and controls the size of the poly(A) tail to about 250 nt. At steady-state, this protein is localized in the nucleus whereas a different poly(A) binding protein is localized in the cytoplasm. This gene contains a GCG trinucleotide repeat at the 5' end of the coding region, and expansion of this repeat from the normal 6 copies to 8-13 copies leads to autosomal dominant oculopharyngeal muscular dystrophy (OPMD) disease. Related pseudogenes have been identified on chromosomes 19 and X. Read-through transcription also exists between this gene and the neighboring upstream BCL2-like 2 (BCL2L2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous KO and poly-alanine KI is embryonic lethal. Heterozygosity affects mitochondria and causes age- and muscle-specific muscle hypo- and hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc4a9 A G 18: 36,530,847 Y308C probably benign Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Pabpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2038:Pabpn1 UTSW 14 54897152 missense probably damaging 0.99
R2081:Pabpn1 UTSW 14 54895658 missense probably damaging 1.00
R5974:Pabpn1 UTSW 14 54897160 missense probably damaging 1.00
R7681:Pabpn1 UTSW 14 54898042 missense probably damaging 0.99
R8831:Pabpn1 UTSW 14 54894457 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGCTCTAGAGAAGGTAAATTGAC -3'
(R):5'- CGTAATGGACTATGACCACAGC -3'

Sequencing Primer
(F):5'- GGAAATGGCCGAGCACG -3'
(R):5'- TGGACTATGACCACAGCACCTG -3'
Posted On2016-07-06