Incidental Mutation 'R5224:Rhag'
ID402525
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene NameRhesus blood group-associated A glycoprotein
SynonymsRh50, CD241, Rh50A
MMRRC Submission 042797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5224 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40811126-40840754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40828504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 110 (L110P)
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721]
Predicted Effect probably damaging
Transcript: ENSMUST00000024721
AA Change: L110P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926
AA Change: L110P

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,719,050 S1014R possibly damaging Het
Ahi1 A G 10: 20,987,022 S699G probably damaging Het
Atp10d C T 5: 72,269,326 A959V probably benign Het
Axl T C 7: 25,786,944 M112V probably benign Het
Btbd11 CGTGACCTTTCTGGT CGT 10: 85,645,522 probably benign Het
Camk1g A T 1: 193,355,034 D119E probably damaging Het
Capn8 A C 1: 182,596,989 N117T probably damaging Het
Cct3 G A 3: 88,297,225 probably benign Het
Csmd3 T C 15: 47,888,684 T1293A possibly damaging Het
D10Jhu81e A G 10: 78,163,533 V148A probably damaging Het
Depdc1b A G 13: 108,384,820 D387G probably damaging Het
Dtx3l A G 16: 35,938,793 Y29H possibly damaging Het
Erp44 A T 4: 48,279,435 N2K probably benign Het
Fmn1 A G 2: 113,365,125 E390G unknown Het
Ganab T A 19: 8,910,591 D396E probably benign Het
Gcc2 T A 10: 58,286,160 S1140T probably damaging Het
Gm10499 G A 17: 36,143,339 noncoding transcript Het
Gm7008 T C 12: 40,223,343 probably benign Het
Gphn T A 12: 78,590,587 F354I probably damaging Het
Hnrnpul1 G A 7: 25,745,175 T236M probably damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
Jaml T A 9: 45,104,266 M356K probably damaging Het
Kbtbd12 T A 6: 88,617,699 probably benign Het
Ldlrad3 G T 2: 102,113,609 N39K probably damaging Het
Lrp1b G A 2: 41,110,840 T2238I possibly damaging Het
Lypd8 T A 11: 58,386,808 C139S possibly damaging Het
Masp1 G T 16: 23,494,695 H163Q probably damaging Het
Mpo T C 11: 87,796,457 probably benign Het
Muc19 A T 15: 91,928,025 noncoding transcript Het
Muc5ac T A 7: 141,793,971 S438T probably benign Het
Nav2 T C 7: 49,551,725 V160A probably benign Het
Nlrc5 G T 8: 94,494,316 A1128S probably benign Het
Nlrp5 T A 7: 23,417,976 L375Q probably damaging Het
Nlrp9a A G 7: 26,557,292 T112A probably benign Het
Nppa T C 4: 148,001,316 S127P probably damaging Het
Olfr1058 A G 2: 86,385,849 S190P possibly damaging Het
Osbpl1a T C 18: 12,933,696 N2S probably benign Het
Otoa A G 7: 121,139,793 T742A probably damaging Het
Pcdh10 A G 3: 45,392,814 R1015G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plpp1 T A 13: 112,851,512 Y56* probably null Het
Ppp1r12a A G 10: 108,261,025 T236A probably benign Het
Scn11a T A 9: 119,754,792 N1586Y probably damaging Het
Sgms2 T A 3: 131,342,117 K36I probably damaging Het
Slc22a2 A G 17: 12,586,832 N157D probably damaging Het
Stx19 T G 16: 62,822,574 M251R probably benign Het
Suco A G 1: 161,834,705 I719T probably benign Het
Tnr A G 1: 159,923,315 D1282G probably damaging Het
Tram1 T C 1: 13,578,125 R154G probably benign Het
Ubtfl1 G T 9: 18,410,030 V285L probably benign Het
Ugt2b38 A G 5: 87,423,742 S144P probably benign Het
Washc2 T G 6: 116,209,004 *58G probably null Het
Zfp354a T A 11: 51,070,049 S362R probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 40811287 missense possibly damaging 0.73
IGL01463:Rhag APN 17 40828755 missense probably damaging 1.00
IGL01954:Rhag APN 17 40828450 missense possibly damaging 0.88
IGL03000:Rhag APN 17 40828522 missense probably benign 0.00
R0385:Rhag UTSW 17 40834727 missense probably damaging 0.97
R0570:Rhag UTSW 17 40828913 splice site probably benign
R0811:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R0812:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R1655:Rhag UTSW 17 40831596 missense probably damaging 0.98
R2376:Rhag UTSW 17 40811363 critical splice donor site probably null
R2698:Rhag UTSW 17 40836476 missense probably damaging 0.99
R4207:Rhag UTSW 17 40831653 missense probably damaging 0.99
R4695:Rhag UTSW 17 40836467 missense probably damaging 0.99
R4705:Rhag UTSW 17 40836438 missense probably benign 0.35
R4729:Rhag UTSW 17 40828401 missense probably damaging 1.00
R4790:Rhag UTSW 17 40831290 missense probably benign 0.23
R4895:Rhag UTSW 17 40811351 missense probably benign
R5685:Rhag UTSW 17 40831331 missense possibly damaging 0.88
R7403:Rhag UTSW 17 40834658 missense probably damaging 1.00
R7407:Rhag UTSW 17 40831334 missense possibly damaging 0.56
R7553:Rhag UTSW 17 40828395 missense probably damaging 1.00
R7884:Rhag UTSW 17 40831645 missense probably benign 0.06
R8056:Rhag UTSW 17 40828788 missense probably damaging 1.00
X0064:Rhag UTSW 17 40833505 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACAACTCTTGGGGTTCTTG -3'
(R):5'- GCTGAAGTCTGCATTTATCATACTG -3'

Sequencing Primer
(F):5'- CTTGGGGTTCTTGTTATACAAAACG -3'
(R):5'- AAGTTTTAGCTTTGAACTGGGCAC -3'
Posted On2016-07-22