Incidental Mutation 'R0470:Wisp1'
ID41821
Institutional Source Beutler Lab
Gene Symbol Wisp1
Ensembl Gene ENSMUSG00000005124
Gene NameWNT1 inducible signaling pathway protein 1
SynonymsCCN4, Elm1
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0470 (G1)
Quality Score166
Status Validated
Chromosome15
Chromosomal Location66891320-66923201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66917378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 238 (I238V)
Ref Sequence ENSEMBL: ENSMUSP00000005255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005255] [ENSMUST00000118823] [ENSMUST00000147079]
Predicted Effect probably benign
Transcript: ENSMUST00000005255
AA Change: I238V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005255
Gene: ENSMUSG00000005124
AA Change: I238V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 6.39e-13 SMART
VWC 123 185 5.63e-13 SMART
TSP1 217 260 4.34e-5 SMART
CT 278 347 1.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118823
SMART Domains Protein: ENSMUSP00000113144
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 3.19e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133863
Predicted Effect probably benign
Transcript: ENSMUST00000147079
SMART Domains Protein: ENSMUSP00000117402
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230535
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit impaired motor coordination during inverted screen testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Wisp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Wisp1 APN 15 66906550 nonsense probably null
IGL03057:Wisp1 APN 15 66891640 splice site probably benign
R0029:Wisp1 UTSW 15 66912864 missense probably damaging 1.00
R0125:Wisp1 UTSW 15 66917345 missense possibly damaging 0.82
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0847:Wisp1 UTSW 15 66919275 missense probably damaging 1.00
R1463:Wisp1 UTSW 15 66919271 missense possibly damaging 0.52
R1623:Wisp1 UTSW 15 66891599 missense possibly damaging 0.46
R1785:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R1786:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R2027:Wisp1 UTSW 15 66917409 missense possibly damaging 0.50
R2104:Wisp1 UTSW 15 66919327 missense probably benign 0.11
R2440:Wisp1 UTSW 15 66912857 missense possibly damaging 0.71
R3791:Wisp1 UTSW 15 66919288 missense probably damaging 1.00
R4748:Wisp1 UTSW 15 66906640 nonsense probably null
R5317:Wisp1 UTSW 15 66917282 missense probably benign
R6960:Wisp1 UTSW 15 66919198 missense probably benign 0.00
R7144:Wisp1 UTSW 15 66913030 missense probably damaging 0.99
R8237:Wisp1 UTSW 15 66919234 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCGTGGAGGCTACAGACTCATAGG -3'
(R):5'- TAACAGCAGAGCGGCATCTGAC -3'

Sequencing Primer
(F):5'- ACAGACTCATAGGTTCTGTGGTATTC -3'
(R):5'- ATTCAGTGGAATCCATCCTGGAC -3'
Posted On2013-05-23