Incidental Mutation 'R0470:Trim66'
ID 41796
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R0470 (G1)
Quality Score 96
Status Validated
Chromosome 7
Chromosomal Location 109449006-109508134 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 109457542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect probably benign
Transcript: ENSMUST00000033339
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106739
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106741
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
R8423:Trim66 UTSW 7 109475392 missense possibly damaging 0.77
R8855:Trim66 UTSW 7 109481981 missense probably damaging 1.00
R9130:Trim66 UTSW 7 109477689 missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109475123 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAACGAATGGATGCCTACTAGCCAC -3'
(R):5'- TTCTTCCCCAAGGTCAGCCAGAAC -3'

Sequencing Primer
(F):5'- TACTAGCCACAGGCTCGAAAG -3'
(R):5'- GAAAGGTCACTGTCACATCTCTG -3'
Posted On 2013-05-23