Incidental Mutation 'R0470:Cfhr2'
ID41778
Institutional Source Beutler Lab
Gene Symbol Cfhr2
Ensembl Gene ENSMUSG00000033898
Gene Namecomplement factor H-related 2
Synonyms
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0470 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139804167-139858702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139821779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 155 (V155E)
Ref Sequence ENSEMBL: ENSMUSP00000092065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094489] [ENSMUST00000194186]
Predicted Effect probably damaging
Transcript: ENSMUST00000094489
AA Change: V155E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092065
Gene: ENSMUSG00000033898
AA Change: V155E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
CCP 270 331 1.16e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194186
AA Change: V155E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142033
Gene: ENSMUSG00000033898
AA Change: V155E

DomainStartEndE-ValueType
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Cfhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cfhr2 APN 1 139831232 missense probably benign 0.09
IGL01721:Cfhr2 APN 1 139813614 missense probably benign 0.00
IGL02160:Cfhr2 APN 1 139810926 missense probably benign
IGL02189:Cfhr2 APN 1 139821759 missense probably damaging 0.98
IGL02802:Cfhr2 APN 1 139811024 intron probably benign
PIT4677001:Cfhr2 UTSW 1 139805379 missense unknown
R0586:Cfhr2 UTSW 1 139813434 nonsense probably null
R1401:Cfhr2 UTSW 1 139811019 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1729:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1729:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1730:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1730:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1739:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1739:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1762:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1762:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1779:Cfhr2 UTSW 1 139858645 splice site probably null
R1783:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1783:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1784:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1784:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1785:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1785:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R2130:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2131:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2141:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2142:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R4626:Cfhr2 UTSW 1 139813576 missense probably damaging 1.00
R4938:Cfhr2 UTSW 1 139813527 missense probably benign 0.02
R5225:Cfhr2 UTSW 1 139821782 missense possibly damaging 0.69
R5578:Cfhr2 UTSW 1 139831068 nonsense probably null
R6144:Cfhr2 UTSW 1 139805415 unclassified probably benign
R6312:Cfhr2 UTSW 1 139831079 missense possibly damaging 0.47
R6370:Cfhr2 UTSW 1 139822327 missense probably damaging 1.00
R6587:Cfhr2 UTSW 1 139810858 missense probably benign 0.01
R7028:Cfhr2 UTSW 1 139831063 critical splice donor site probably null
R7051:Cfhr2 UTSW 1 139810978 missense probably benign 0.00
R7162:Cfhr2 UTSW 1 139813526 missense probably benign 0.08
R7166:Cfhr2 UTSW 1 139831101 nonsense probably null
R7503:Cfhr2 UTSW 1 139831214 missense probably damaging 0.99
R7752:Cfhr2 UTSW 1 139813584 missense probably damaging 1.00
R8322:Cfhr2 UTSW 1 139810958 missense probably benign
R8498:Cfhr2 UTSW 1 139813481 missense possibly damaging 0.81
R8735:Cfhr2 UTSW 1 139858605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCCACAGTTAATACAGAAGGGACAG -3'
(R):5'- ACACACAATAGGGACTATGGAAATGCC -3'

Sequencing Primer
(F):5'- TCATGAGAAACTTGTGATGTAAGG -3'
(R):5'- GGGACTATGGAAATGCCTTTATC -3'
Posted On2013-05-23