Incidental Mutation 'R0470:Tgfb1'
ID41794
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Nametransforming growth factor, beta 1
SynonymsTgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R0470 (G1)
Quality Score82
Status Validated
Chromosome7
Chromosomal Location25687002-25705077 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 25687930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000169009] [ENSMUST00000205325] [ENSMUST00000205658] [ENSMUST00000206913]
Predicted Effect unknown
Transcript: ENSMUST00000002678
AA Change: L21Q
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603
AA Change: L21Q

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108403
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171757
Predicted Effect probably benign
Transcript: ENSMUST00000205325
Predicted Effect probably benign
Transcript: ENSMUST00000205658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206584
Predicted Effect probably benign
Transcript: ENSMUST00000206913
Meta Mutation Damage Score 0.1237 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25688017 missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25704196 missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25696918 missense probably benign
R0004:Tgfb1 UTSW 7 25692366 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R1872:Tgfb1 UTSW 7 25692466 missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25704809 missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25697230 missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25688149 missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25694281 missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25696960 missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25696925 missense probably benign 0.01
R6727:Tgfb1 UTSW 7 25689162 unclassified probably benign
R7203:Tgfb1 UTSW 7 25692539 critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25704838 missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25687695 unclassified probably benign
Z1177:Tgfb1 UTSW 7 25688208 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCCACTTTTGGATCTCAGAGAGC -3'
(R):5'- ACGCGGGTGACCTCTTTAGCATAG -3'

Sequencing Primer
(F):5'- TCCCTCAACCTCAAATTATTCAGG -3'
(R):5'- AGCATAGTAGTCCGCTTCG -3'
Posted On2013-05-23