Incidental Mutation 'R0477:Olfr1100'
ID41833
Institutional Source Beutler Lab
Gene Symbol Olfr1100
Ensembl Gene ENSMUSG00000070875
Gene Nameolfactory receptor 1100
SynonymsGA_x6K02T2Q125-48465387-48464422, MOR206-4
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0477 (G1)
Quality Score174
Status Validated (trace)
Chromosome2
Chromosomal Location86976029-86979954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86978223 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000151088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094913] [ENSMUST00000117211]
Predicted Effect probably damaging
Transcript: ENSMUST00000094913
AA Change: D191V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092517
Gene: ENSMUSG00000070875
AA Change: D191V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 314 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117211
AA Change: D191V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.2647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Olfr1100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Olfr1100 APN 2 86977849 nonsense probably null
R0102:Olfr1100 UTSW 2 86978205 missense possibly damaging 0.90
R0586:Olfr1100 UTSW 2 86978782 missense probably damaging 0.99
R0743:Olfr1100 UTSW 2 86978499 missense probably benign 0.12
R1163:Olfr1100 UTSW 2 86978676 missense probably damaging 1.00
R1640:Olfr1100 UTSW 2 86978619 missense probably damaging 1.00
R2865:Olfr1100 UTSW 2 86978461 missense possibly damaging 0.56
R4478:Olfr1100 UTSW 2 86978218 missense probably benign
R4548:Olfr1100 UTSW 2 86978670 missense probably damaging 0.98
R4618:Olfr1100 UTSW 2 86978274 missense possibly damaging 0.87
R4829:Olfr1100 UTSW 2 86978574 missense probably damaging 0.99
R4858:Olfr1100 UTSW 2 86978349 missense probably damaging 1.00
R5071:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5072:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5073:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5074:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5574:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R5735:Olfr1100 UTSW 2 86978700 missense probably benign 0.08
R5874:Olfr1100 UTSW 2 86978442 missense probably damaging 0.99
R6228:Olfr1100 UTSW 2 86978691 missense probably damaging 1.00
R6689:Olfr1100 UTSW 2 86978154 missense probably benign 0.36
R6979:Olfr1100 UTSW 2 86978233 missense probably damaging 1.00
R7006:Olfr1100 UTSW 2 86977959 missense probably damaging 0.99
R7274:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R7399:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R7560:Olfr1100 UTSW 2 86978778 missense probably benign 0.00
R7765:Olfr1100 UTSW 2 86978194 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGAAGCCACTTGTTCCTTTCCTG -3'
(R):5'- AGATGCTCAGCTTCACACTCCAATG -3'

Sequencing Primer
(F):5'- ACTTGTTCCTTTCCTGAGTAGTAG -3'
(R):5'- GATATGTGGCTATTTGCAACCC -3'
Posted On2013-05-23