Incidental Mutation 'R5378:Rbm28'
ID425685
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29128559 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 55 (K55E)
Ref Sequence ENSEMBL: ENSMUSP00000127856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993] [ENSMUST00000164563]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007993
AA Change: K629E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701
AA Change: K629E

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164563
AA Change: K55E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127856
Gene: ENSMUSG00000029701
AA Change: K55E

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169214
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0654:Rbm28 UTSW 6 29128578 missense probably damaging 1.00
R0884:Rbm28 UTSW 6 29155154 missense possibly damaging 0.68
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 unclassified probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4421:Rbm28 UTSW 6 29154837 missense probably damaging 1.00
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7351:Rbm28 UTSW 6 29158880 missense probably benign
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
RF056:Rbm28 UTSW 6 29157053 frame shift probably null
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTATCCTCCCATGGGAAAGGGAG -3'
(R):5'- ATCTCAGCTGGAAGTCAGGG -3'

Sequencing Primer
(F):5'- TTTTGTCCTCCCAAATGCAGCAAAG -3'
(R):5'- AGCTGGAAGTCAGGGGCTATTTC -3'
Posted On2016-08-04