Incidental Mutation 'R7351:Rbm28'
ID570567
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7351 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29158880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000007993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993]
PDB Structure
Solution structure of RRM domain in RNA-binding protein 28 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000007993
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701
AA Change: T139A

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,412,510 G343V probably damaging Het
1700006E09Rik A G 11: 101,991,505 E163G probably benign Het
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adamts6 G A 13: 104,390,112 S516N possibly damaging Het
Ahi1 A G 10: 20,965,933 D301G probably damaging Het
Arhgef37 T A 18: 61,498,215 L566F possibly damaging Het
AU040320 A G 4: 126,816,444 N328D probably damaging Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Brk1 T C 6: 113,615,781 S42P probably benign Het
Ccdc180 A G 4: 45,903,887 E351G possibly damaging Het
Cenpo A T 12: 4,216,581 F176I probably damaging Het
Clec12b A G 6: 129,379,911 probably null Het
Ddx42 A G 11: 106,247,682 N769S probably benign Het
Drc7 A G 8: 95,058,507 D165G probably benign Het
Dync2h1 A T 9: 7,167,145 I486N probably damaging Het
Gmip A G 8: 69,817,384 D679G probably benign Het
Gml2 T C 15: 74,821,376 V76A possibly damaging Het
Gpr26 T C 7: 131,974,365 C253R probably damaging Het
H2-Q4 A G 17: 35,382,878 T239A possibly damaging Het
Hmcn1 T A 1: 150,667,889 Y2845F probably damaging Het
Ift172 A G 5: 31,275,896 Y550H probably damaging Het
Irgm2 G A 11: 58,219,605 V41M possibly damaging Het
Lrp2 C T 2: 69,448,142 G3956R probably damaging Het
Matn2 G A 15: 34,345,336 R163H probably damaging Het
Mxd1 A G 6: 86,651,466 S151P probably damaging Het
Olfr1022 G T 2: 85,864,071 probably benign Het
Olfr1246 C T 2: 89,590,513 G201S probably benign Het
Olfr1330 T C 4: 118,893,836 V251A probably benign Het
Olfr147 C T 9: 38,403,443 L190F probably damaging Het
Plcg2 A G 8: 117,590,310 E642G possibly damaging Het
Pramel6 T A 2: 87,510,328 F335I probably benign Het
Psd G T 19: 46,322,430 S393R probably benign Het
Pwwp2a A G 11: 43,682,280 D63G probably benign Het
Ripk2 T G 4: 16,155,048 E157A probably damaging Het
Rnf145 G A 11: 44,548,796 V140I possibly damaging Het
Rnf38 T C 4: 44,149,102 N114D probably benign Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Sec14l3 A G 11: 4,074,785 T245A probably benign Het
Serpina10 A T 12: 103,628,935 F8L probably benign Het
Slc16a8 T A 15: 79,253,641 D56V probably damaging Het
Spag9 A T 11: 94,092,976 E726D probably benign Het
Spg11 A G 2: 122,069,931 F1547L possibly damaging Het
Sspo T C 6: 48,464,921 I1955T possibly damaging Het
Stx18 T A 5: 38,039,411 V27E probably benign Het
Taf1c A G 8: 119,599,000 S708P probably damaging Het
Tas2r126 T C 6: 42,435,306 F258L probably benign Het
Tdpoz2 C T 3: 93,652,593 W24* probably null Het
Tmc8 T C 11: 117,783,828 L123P probably damaging Het
Trmo A T 4: 46,387,716 Y35N possibly damaging Het
Ttn C T 2: 76,767,686 V19628I possibly damaging Het
Ttn G A 2: 76,939,930 A2685V unknown Het
Usp15 A T 10: 123,132,999 M349K probably damaging Het
Vmn2r89 A G 14: 51,456,282 N363S probably benign Het
Vwa3a T A 7: 120,776,336 I423N probably damaging Het
Zfp592 T C 7: 81,041,691 V1206A probably benign Het
Zfp866 A T 8: 69,765,897 Y358N probably damaging Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0654:Rbm28 UTSW 6 29128578 missense probably damaging 1.00
R0884:Rbm28 UTSW 6 29155154 missense possibly damaging 0.68
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 splice site probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4421:Rbm28 UTSW 6 29154837 missense probably damaging 1.00
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5378:Rbm28 UTSW 6 29128559 missense probably damaging 0.99
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
RF056:Rbm28 UTSW 6 29157053 frame shift probably null
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACTATGCCAGGCAATCTGC -3'
(R):5'- TGCTGTTCTAATCGTGAAAGCTTAG -3'

Sequencing Primer
(F):5'- CTTTATCAAGCAGGACTACGGTG -3'
(R):5'- TCTAATCGTGAAAGCTTAGCAGAAAG -3'
Posted On2019-09-13