Mutagenetix > Incidental Mutations

Incidental Mutation 'R5414:Fbn2'

427662

Institutional Source

Beutler Lab

Gene Symbol

Fbn2

Ensembl Gene

ENSMUSG00000024598

Gene Name

fibrillin 2

Synonyms

Fib-2, sy, Sne

MMRRC Submission

042983-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.877) question?

Stock #

R5414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58008623-58209926 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 58093405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 766 (A766S)

Ref Sequence

ENSEMBL: ENSMUSP00000025497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025497]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025497
AA Change: A766S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: A766S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	29	52	N/A	INTRINSIC
low complexity region	68	77	N/A	INTRINSIC
EGF	148	176	1.15e1	SMART
EGF	179	208	1.26e-2	SMART
Pfam:TB	224	262	3.7e-10	PFAM
EGF_CA	276	317	8.3e-12	SMART
EGF_CA	318	359	9.25e-10	SMART
Pfam:TB	374	416	4.3e-13	PFAM
low complexity region	435	450	N/A	INTRINSIC
low complexity region	463	475	N/A	INTRINSIC
EGF	490	527	1.13e-4	SMART
EGF_CA	528	567	2.26e-13	SMART
EGF_CA	568	609	9.03e-13	SMART
EGF_CA	610	650	6.2e-11	SMART
EGF_CA	651	691	7.75e-12	SMART
Pfam:TB	707	748	5.2e-15	PFAM
EGF_CA	761	802	6.29e-12	SMART
EGF_CA	803	844	1.97e-13	SMART
EGF_CA	845	884	1.61e-9	SMART
Pfam:TB	899	935	1.8e-9	PFAM
EGF_CA	948	989	4.7e-11	SMART
Pfam:TB	1004	1044	1.3e-16	PFAM
EGF_CA	1066	1107	3.05e-10	SMART
EGF_CA	1108	1150	2.19e-11	SMART
EGF_CA	1151	1192	2.04e-11	SMART
EGF_CA	1193	1234	3.15e-12	SMART
EGF_CA	1235	1275	1.82e-8	SMART
EGF_CA	1276	1317	9.91e-10	SMART
EGF_CA	1318	1359	1.48e-8	SMART
EGF_CA	1360	1400	6.54e-10	SMART
EGF_CA	1401	1441	4.63e-10	SMART
EGF_CA	1442	1483	7.75e-12	SMART
EGF_CA	1484	1524	5.23e-9	SMART
EGF_CA	1525	1565	2.13e-9	SMART
Pfam:TB	1585	1625	3.4e-15	PFAM
EGF_CA	1643	1684	6.74e-12	SMART
EGF_CA	1685	1726	1.06e-9	SMART
Pfam:TB	1741	1783	1.2e-17	PFAM
EGF_CA	1801	1842	7.34e-13	SMART
EGF_CA	1843	1884	4.15e-12	SMART
EGF_CA	1885	1926	5.23e-9	SMART
EGF_CA	1927	1965	5.87e-12	SMART
EGF_CA	1966	2008	1.11e-12	SMART
EGF_CA	2009	2048	1.26e-11	SMART
EGF_CA	2049	2090	7.12e-11	SMART
Pfam:TB	2105	2147	1.2e-15	PFAM
EGF_CA	2164	2205	2.89e-11	SMART
EGF_CA	2206	2245	1.1e-11	SMART
EGF_CA	2246	2286	3.76e-10	SMART
EGF_CA	2287	2330	1.44e-6	SMART
EGF_CA	2331	2372	1.16e-10	SMART
Pfam:TB	2387	2429	1.9e-16	PFAM
EGF_CA	2442	2483	8.43e-13	SMART
EGF_CA	2484	2524	4.96e-10	SMART
EGF_CA	2525	2563	7.63e-11	SMART
EGF_CA	2564	2606	6.44e-9	SMART
EGF_CA	2607	2646	2.28e-9	SMART
EGF_CA	2647	2687	1.79e-7	SMART
EGF_CA	2688	2727	3.45e-9	SMART
low complexity region	2774	2786	N/A	INTRINSIC

Meta Mutation Damage Score

0.1777

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,314,622	S278P	probably damaging	Het
Acan	A	G	7: 79,100,988	T1836A	probably benign	Het
Akr1c18	T	A	13: 4,136,735	D238V	probably damaging	Het
Akt3	A	G	1: 177,050,251	V317A	probably damaging	Het
Atp2b2	G	A	6: 113,842,141	P64S	probably damaging	Het
Atr	A	G	9: 95,870,704	N609S	probably benign	Het
Bcat1	A	G	6: 145,015,447		probably null	Het
C1rl	C	T	6: 124,508,468	A266V	probably damaging	Het
Cd34	A	G	1: 194,947,911	E51G	probably benign	Het
Celsr3	A	G	9: 108,840,042	E2161G	possibly damaging	Het
Clec2h	G	T	6: 128,674,786	A153S	probably benign	Het
Cnih1	T	C	14: 46,778,983	T105A	probably benign	Het
Coro1c	A	G	5: 113,848,546	I279T	possibly damaging	Het
Ddx11	A	G	17: 66,148,768	T721A	probably benign	Het
Focad	C	T	4: 88,410,702		probably benign	Het
Galnt16	A	T	12: 80,584,048	D300V	probably damaging	Het
Gbp2b	T	C	3: 142,599,091	L96P	probably damaging	Het
Gm10192	T	C	4: 97,183,109	S20G	probably null	Het
Gm10288	T	C	3: 146,838,962		noncoding transcript	Het
Gm21761	A	C	13: 119,912,336	D139E	probably damaging	Het
Gm4181	C	T	14: 51,635,590		probably null	Het
Gm6327	T	A	16: 12,760,358		noncoding transcript	Het
Hfm1	A	G	5: 106,902,076	I409T	probably damaging	Het
Ibtk	T	C	9: 85,726,689	E390G	possibly damaging	Het
Ifit1bl1	T	A	19: 34,593,924	I378F	probably damaging	Het
Kcnh4	T	C	11: 100,746,896	D645G	probably damaging	Het
Krt33b	T	C	11: 100,029,786	T14A	probably benign	Het
Lrch3	T	A	16: 32,985,965		probably null	Het
Mycbp2	A	T	14: 103,306,261	L226H	probably damaging	Het
Myo1e	C	A	9: 70,322,358		probably null	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Nploc4	A	T	11: 120,413,643	Y251N	probably damaging	Het
Olfr1271	T	C	2: 90,265,702	T243A	probably benign	Het
Pdk4	T	C	6: 5,485,499	I397V	probably benign	Het
Pdzrn3	C	T	6: 101,153,311	D515N	probably damaging	Het
Pgm5	A	G	19: 24,709,325	I506T	probably damaging	Het
Pgs1	T	G	11: 118,014,676	I499S	probably damaging	Het
Ppp6r3	A	G	19: 3,507,330	S253P	probably damaging	Het
Prag1	C	G	8: 36,139,622	P839R	probably benign	Het
Rin3	C	T	12: 102,389,857	Q806*	probably null	Het
Ros1	T	C	10: 52,155,093	D484G	probably damaging	Het
Scamp5	A	G	9: 57,447,224	V49A	probably benign	Het
Sis	C	A	3: 72,952,493	V310L	probably benign	Het
Svep1	T	C	4: 58,206,322	T19A	possibly damaging	Het
Tenm3	A	C	8: 48,236,355	S2066A	probably damaging	Het
Thra	A	G	11: 98,760,957	I102V	probably benign	Het
Trim30a	A	C	7: 104,411,141	V476G	probably damaging	Het
Vmn2r3	T	A	3: 64,259,557	R718*	probably null	Het
Washc4	A	G	10: 83,556,103	T218A	possibly damaging	Het
Xrcc1	A	G	7: 24,570,218	Y401C	probably damaging	Het
Zfp629	T	C	7: 127,611,282	T452A	probably damaging	Het

Other mutations in Fbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Fbn2	APN	18	58037809	missense	possibly damaging	0.81
IGL00780:Fbn2	APN	18	58095988	missense	probably damaging	1.00
IGL00923:Fbn2	APN	18	58012325	missense	probably benign	0.00
IGL01011:Fbn2	APN	18	58095240	splice site	probably benign
IGL01123:Fbn2	APN	18	58104081	missense	possibly damaging	0.62
IGL01304:Fbn2	APN	18	58061745	missense	probably damaging	0.97
IGL01339:Fbn2	APN	18	58113370	missense	possibly damaging	0.75
IGL01465:Fbn2	APN	18	58203833	missense	probably null	0.67
IGL01608:Fbn2	APN	18	58053704	nonsense	probably null
IGL01682:Fbn2	APN	18	58072671	missense	probably damaging	1.00
IGL01752:Fbn2	APN	18	58075977	splice site	probably null
IGL01764:Fbn2	APN	18	58045351	missense	probably damaging	1.00
IGL02002:Fbn2	APN	18	58114553	missense	probably benign	0.01
IGL02010:Fbn2	APN	18	58037722	missense	probably damaging	0.99
IGL02029:Fbn2	APN	18	58209603	missense	probably benign	0.04
IGL02037:Fbn2	APN	18	58096015	missense	probably damaging	1.00
IGL02350:Fbn2	APN	18	58103995	missense	possibly damaging	0.71
IGL02357:Fbn2	APN	18	58103995	missense	possibly damaging	0.71
IGL02653:Fbn2	APN	18	58076705	missense	probably benign
IGL03233:Fbn2	APN	18	58102377	missense	probably benign	0.39
IGL03347:Fbn2	APN	18	58013665	missense	probably damaging	1.00
IGL03410:Fbn2	APN	18	58050243	missense	possibly damaging	0.95
pinch	UTSW	18	58069184	missense	probably damaging	1.00
stick	UTSW	18	58071819	missense	possibly damaging	0.94
tweak	UTSW	18	58058389	missense	probably damaging	1.00
BB009:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
BB019:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
PIT4434001:Fbn2	UTSW	18	58096062	missense	probably damaging	0.99
R0020:Fbn2	UTSW	18	58105164	missense	probably damaging	1.00
R0069:Fbn2	UTSW	18	58069184	missense	probably damaging	1.00
R0107:Fbn2	UTSW	18	58056203	missense	probably benign	0.00
R0116:Fbn2	UTSW	18	58102373	nonsense	probably null
R0277:Fbn2	UTSW	18	58045317	missense	probably damaging	1.00
R0284:Fbn2	UTSW	18	58050290	splice site	probably benign
R0316:Fbn2	UTSW	18	58113325	missense	probably damaging	1.00
R0323:Fbn2	UTSW	18	58045317	missense	probably damaging	1.00
R0421:Fbn2	UTSW	18	58027804	splice site	probably benign
R0455:Fbn2	UTSW	18	58035336	missense	probably damaging	1.00
R0504:Fbn2	UTSW	18	58039460	missense	possibly damaging	0.94
R0520:Fbn2	UTSW	18	58013749	missense	probably damaging	1.00
R0632:Fbn2	UTSW	18	58037747	missense	probably damaging	1.00
R0638:Fbn2	UTSW	18	58045374	missense	probably damaging	0.98
R0645:Fbn2	UTSW	18	58058389	missense	probably damaging	1.00
R1051:Fbn2	UTSW	18	58012353	missense	probably damaging	0.99
R1209:Fbn2	UTSW	18	58070016	missense	probably benign	0.00
R1319:Fbn2	UTSW	18	58200610	missense	possibly damaging	0.88
R1400:Fbn2	UTSW	18	58080193	missense	possibly damaging	0.90
R1437:Fbn2	UTSW	18	58053659	missense	possibly damaging	0.68
R1463:Fbn2	UTSW	18	58010380	missense	probably benign
R1612:Fbn2	UTSW	18	58061752	missense	probably damaging	1.00
R1623:Fbn2	UTSW	18	58048548	missense	possibly damaging	0.61
R1629:Fbn2	UTSW	18	58026538	missense	probably damaging	1.00
R1639:Fbn2	UTSW	18	58058462	missense	probably benign	0.41
R1722:Fbn2	UTSW	18	58048052	critical splice acceptor site	probably null
R1749:Fbn2	UTSW	18	58050276	missense	probably benign	0.35
R1802:Fbn2	UTSW	18	58052976	nonsense	probably null
R1850:Fbn2	UTSW	18	58039305	splice site	probably benign
R1913:Fbn2	UTSW	18	58061742	missense	probably damaging	1.00
R2045:Fbn2	UTSW	18	58090658	missense	probably damaging	1.00
R2064:Fbn2	UTSW	18	58048849	missense	probably damaging	0.99
R2143:Fbn2	UTSW	18	58052993	missense	possibly damaging	0.65
R2144:Fbn2	UTSW	18	58052993	missense	possibly damaging	0.65
R2149:Fbn2	UTSW	18	58102325	splice site	probably null
R2207:Fbn2	UTSW	18	58081399	nonsense	probably null
R2219:Fbn2	UTSW	18	58052963	missense	possibly damaging	0.79
R2263:Fbn2	UTSW	18	58095176	splice site	probably benign
R2375:Fbn2	UTSW	18	58035966	missense	probably damaging	1.00
R2424:Fbn2	UTSW	18	58203787	missense	probably damaging	0.99
R2504:Fbn2	UTSW	18	58093359	missense	probably damaging	0.99
R2879:Fbn2	UTSW	18	58069242	missense	probably damaging	0.97
R3040:Fbn2	UTSW	18	58093387	missense	probably damaging	1.00
R3080:Fbn2	UTSW	18	58149050	missense	probably damaging	0.97
R3625:Fbn2	UTSW	18	58061742	missense	probably damaging	1.00
R3901:Fbn2	UTSW	18	58066011	missense	probably damaging	0.97
R4089:Fbn2	UTSW	18	58053769	missense	probably benign	0.01
R4133:Fbn2	UTSW	18	58095962	missense	possibly damaging	0.82
R4155:Fbn2	UTSW	18	58023287	nonsense	probably null
R4288:Fbn2	UTSW	18	58035339	missense	probably damaging	0.98
R4289:Fbn2	UTSW	18	58035339	missense	probably damaging	0.98
R4363:Fbn2	UTSW	18	58149050	missense	probably damaging	0.97
R4559:Fbn2	UTSW	18	58076074	missense	probably benign	0.00
R4601:Fbn2	UTSW	18	58053733	missense	probably damaging	1.00
R4609:Fbn2	UTSW	18	58190269	nonsense	probably null
R4626:Fbn2	UTSW	18	58013747	nonsense	probably null
R4638:Fbn2	UTSW	18	58010304	missense	probably benign	0.01
R4675:Fbn2	UTSW	18	58040193	missense	possibly damaging	0.95
R4707:Fbn2	UTSW	18	58056272	missense	probably damaging	1.00
R4758:Fbn2	UTSW	18	58026386	missense	probably benign	0.00
R4945:Fbn2	UTSW	18	58050253	missense	possibly damaging	0.53
R4955:Fbn2	UTSW	18	58058383	missense	possibly damaging	0.61
R4980:Fbn2	UTSW	18	58010631	missense	probably benign	0.05
R4998:Fbn2	UTSW	18	58072631	missense	probably damaging	1.00
R5133:Fbn2	UTSW	18	58039340	missense	probably damaging	0.99
R5322:Fbn2	UTSW	18	58039315	missense	probably benign	0.00
R5538:Fbn2	UTSW	18	58071901	missense	probably benign	0.22
R5557:Fbn2	UTSW	18	58115659	missense	probably benign	0.00
R5754:Fbn2	UTSW	18	58124311	missense	probably benign	0.04
R5769:Fbn2	UTSW	18	58105199	missense	probably damaging	1.00
R5790:Fbn2	UTSW	18	58076696	missense	probably benign	0.34
R5830:Fbn2	UTSW	18	58114469	missense	probably benign	0.01
R5845:Fbn2	UTSW	18	58053768	missense	possibly damaging	0.89
R5880:Fbn2	UTSW	18	58023282	nonsense	probably null
R5907:Fbn2	UTSW	18	58045337	missense	probably damaging	1.00
R5948:Fbn2	UTSW	18	58037049	missense	probably damaging	1.00
R5955:Fbn2	UTSW	18	58044256	missense	probably damaging	1.00
R5974:Fbn2	UTSW	18	58048920	missense	probably damaging	1.00
R6010:Fbn2	UTSW	18	58069524	missense	probably benign	0.31
R6024:Fbn2	UTSW	18	58076836	missense	probably benign	0.03
R6037:Fbn2	UTSW	18	58044223	missense	probably benign	0.05
R6037:Fbn2	UTSW	18	58044223	missense	probably benign	0.05
R6315:Fbn2	UTSW	18	58054953	critical splice acceptor site	probably null
R6437:Fbn2	UTSW	18	58113363	missense	probably damaging	1.00
R6519:Fbn2	UTSW	18	58063575	missense	possibly damaging	0.61
R6520:Fbn2	UTSW	18	58102390	missense	probably damaging	1.00
R6734:Fbn2	UTSW	18	58035960	missense	probably damaging	1.00
R6755:Fbn2	UTSW	18	58113333	missense	possibly damaging	0.89
R6789:Fbn2	UTSW	18	58010614	missense	probably benign	0.00
R6801:Fbn2	UTSW	18	58113348	missense	probably benign	0.04
R6862:Fbn2	UTSW	18	58124321	missense	probably benign	0.04
R6900:Fbn2	UTSW	18	58076831	missense	probably benign
R6906:Fbn2	UTSW	18	58071819	missense	possibly damaging	0.94
R6919:Fbn2	UTSW	18	58124187	splice site	probably null
R6950:Fbn2	UTSW	18	58035921	missense	probably null	0.21
R6985:Fbn2	UTSW	18	58068388	missense	probably damaging	1.00
R7056:Fbn2	UTSW	18	58076726	missense	probably benign
R7199:Fbn2	UTSW	18	58053761	nonsense	probably null
R7219:Fbn2	UTSW	18	58053027	missense	probably benign	0.04
R7226:Fbn2	UTSW	18	58037070	missense	probably damaging	1.00
R7260:Fbn2	UTSW	18	58066116	missense	probably benign	0.14
R7414:Fbn2	UTSW	18	58096050	missense	probably damaging	1.00
R7485:Fbn2	UTSW	18	58071840	missense	possibly damaging	0.50
R7523:Fbn2	UTSW	18	58066080	missense	probably benign	0.01
R7549:Fbn2	UTSW	18	58020464	nonsense	probably null
R7619:Fbn2	UTSW	18	58080227	missense	possibly damaging	0.46
R7638:Fbn2	UTSW	18	58105136	missense	probably damaging	1.00
R7789:Fbn2	UTSW	18	58039313	missense	probably benign	0.22
R7932:Fbn2	UTSW	18	58020483	missense	possibly damaging	0.61
R8013:Fbn2	UTSW	18	58104081	missense	possibly damaging	0.62
R8076:Fbn2	UTSW	18	58026424	nonsense	probably null
R8300:Fbn2	UTSW	18	58209615	missense	probably benign
R8345:Fbn2	UTSW	18	58058431	missense	probably damaging	1.00
R8487:Fbn2	UTSW	18	58020390	missense	possibly damaging	0.53
R8520:Fbn2	UTSW	18	58038198	critical splice donor site	probably null
R8781:Fbn2	UTSW	18	58061647	missense	possibly damaging	0.88
R8801:Fbn2	UTSW	18	58153949	missense	probably damaging	1.00
R8857:Fbn2	UTSW	18	58153861	missense	probably damaging	1.00
R8878:Fbn2	UTSW	18	58124246	missense	probably benign	0.30
R8909:Fbn2	UTSW	18	58059436	missense	possibly damaging	0.88
R8973:Fbn2	UTSW	18	58153856	missense	probably damaging	1.00
R8975:Fbn2	UTSW	18	58153856	missense	probably damaging	1.00
R8979:Fbn2	UTSW	18	58153856	missense	probably damaging	1.00
R8991:Fbn2	UTSW	18	58106323	missense	probably damaging	1.00
R9003:Fbn2	UTSW	18	58043519	missense	probably damaging	1.00
R9205:Fbn2	UTSW	18	58059356	missense	probably damaging	1.00
R9215:Fbn2	UTSW	18	58076675	missense	probably damaging	1.00
R9263:Fbn2	UTSW	18	58124272	missense	probably damaging	1.00
R9307:Fbn2	UTSW	18	58209784	missense	probably benign
R9337:Fbn2	UTSW	18	58209651	missense	probably benign
R9403:Fbn2	UTSW	18	58066107	missense	probably damaging	1.00
X0062:Fbn2	UTSW	18	58056213	missense	probably damaging	1.00
Z1177:Fbn2	UTSW	18	58010379	missense	probably benign	0.00
Z1177:Fbn2	UTSW	18	58055482	missense	probably benign	0.00
Z1177:Fbn2	UTSW	18	58069190	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTGCAAAACTCAGTTCG -3'
(R):5'- TACCAGTGGAGTGTCTTGTATCC -3'

Sequencing Primer
(F):5'- GCAAAACTCAGTTCGAATGCTTCTG -3'
(R):5'- TTCACATGTTGGAAGTTCC -3'

Posted On

2016-09-01