Incidental Mutation 'R8975:Fbn2'
ID 683412
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Name fibrillin 2
Synonyms Fib-2, sy, Sne
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock # R8975 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 58008623-58209926 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58153856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 244 (G244R)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000025497
AA Change: G244R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: G244R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,772,746 Y93N probably damaging Het
1700018F24Rik A G 5: 145,043,382 D47G probably damaging Het
4921507P07Rik C T 6: 50,584,411 R176H probably damaging Het
4930550C14Rik A T 9: 53,422,958 K167M possibly damaging Het
Abhd16b A G 2: 181,494,013 N236S probably benign Het
Ahnak T G 19: 9,012,737 V3795G probably damaging Het
Atg2b A T 12: 105,636,466 M1606K probably damaging Het
Bmt2 A T 6: 13,630,612 I187K probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cep290 A G 10: 100,513,920 N610D possibly damaging Het
Ctps C T 4: 120,549,546 D338N probably benign Het
Ctsz A T 2: 174,433,628 I118N probably benign Het
Depdc1b A G 13: 108,388,560 E483G probably null Het
Dhh T C 15: 98,898,095 S60G probably damaging Het
Dpy19l1 T C 9: 24,447,806 K162R probably damaging Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Dyrk4 T C 6: 126,894,820 N162D probably benign Het
Eml5 T A 12: 98,810,570 T1429S probably damaging Het
Fer1l5 A G 1: 36,417,816 D1625G probably benign Het
Frmd4b G A 6: 97,306,516 T484M possibly damaging Het
Gm11487 A G 4: 73,401,930 L204P probably damaging Het
Gm11639 A G 11: 105,063,589 K5090E probably benign Het
Hhat T C 1: 192,748,942 E33G probably damaging Het
Ifngr1 A G 10: 19,609,612 D453G probably damaging Het
Itpr3 T A 17: 27,116,654 I2246N possibly damaging Het
Larp4b T G 13: 9,145,501 I212S probably damaging Het
Lilra5 T C 7: 4,238,637 V145A probably benign Het
Map1lc3a A G 2: 155,277,006 K30R possibly damaging Het
Mapk8ip1 A G 2: 92,384,821 Y652H probably damaging Het
Med23 A G 10: 24,904,436 E994G probably benign Het
Mep1b A T 18: 21,075,657 D30V probably benign Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mki67 T C 7: 135,698,400 D1635G probably benign Het
Mup3 A T 4: 62,085,235 D132E probably benign Het
Myo15b A T 11: 115,890,954 T2830S unknown Het
Myocd T A 11: 65,178,461 H979L probably damaging Het
Nvl A T 1: 181,130,436 N260K probably benign Het
Olfr463 T A 11: 87,893,819 Y35F probably damaging Het
Olfr47 T A 6: 43,236,122 H171Q probably benign Het
Olfr715b T A 7: 107,106,457 T135S probably benign Het
Pdha2 C A 3: 141,211,888 probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phtf2 A C 5: 20,764,251 V687G probably damaging Het
Plagl2 C T 2: 153,232,426 G185D possibly damaging Het
Ppp1r3e A G 14: 54,876,489 V242A probably benign Het
Proser3 A G 7: 30,540,033 S549P possibly damaging Het
Prrc2c A G 1: 162,706,061 V995A unknown Het
Ptpn13 A G 5: 103,501,400 H223R probably benign Het
Rbm33 TCCACCACCACCACCACCACC TCCACCACCACCACCACC 5: 28,361,993 probably benign Het
Rsf1 CG CGTCGGCGGGG 7: 97,579,908 probably benign Het
Scn11a T C 9: 119,758,499 E1393G probably damaging Het
Sipa1l1 T A 12: 82,432,838 S1432T possibly damaging Het
Slc10a5 G C 3: 10,334,610 A330G probably benign Het
Slc2a5 A C 4: 150,139,813 N293H probably damaging Het
Sptbn1 T C 11: 30,123,869 E1400G possibly damaging Het
Stk33 T A 7: 109,336,073 I171F probably damaging Het
Syne1 G A 10: 5,211,945 H5450Y probably benign Het
Tpra1 A T 6: 88,911,744 M303L probably benign Het
Ubr3 T C 2: 69,922,307 S303P probably damaging Het
Uqcrc1 T C 9: 108,947,653 F341S probably damaging Het
Vmn1r223 T C 13: 23,250,078 S281P possibly damaging Het
Vmn1r32 C A 6: 66,553,205 A196S probably benign Het
Zfp644 G T 5: 106,637,601 T360N probably benign Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
BB009:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
BB019:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 splice site probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
R7199:Fbn2 UTSW 18 58053761 nonsense probably null
R7219:Fbn2 UTSW 18 58053027 missense probably benign 0.04
R7226:Fbn2 UTSW 18 58037070 missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58066116 missense probably benign 0.14
R7414:Fbn2 UTSW 18 58096050 missense probably damaging 1.00
R7485:Fbn2 UTSW 18 58071840 missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58066080 missense probably benign 0.01
R7549:Fbn2 UTSW 18 58020464 nonsense probably null
R7619:Fbn2 UTSW 18 58080227 missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58105136 missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58039313 missense probably benign 0.22
R7932:Fbn2 UTSW 18 58020483 missense possibly damaging 0.61
R8013:Fbn2 UTSW 18 58104081 missense possibly damaging 0.62
R8076:Fbn2 UTSW 18 58026424 nonsense probably null
R8300:Fbn2 UTSW 18 58209615 missense probably benign
R8345:Fbn2 UTSW 18 58058431 missense probably damaging 1.00
R8487:Fbn2 UTSW 18 58020390 missense possibly damaging 0.53
R8520:Fbn2 UTSW 18 58038198 critical splice donor site probably null
R8781:Fbn2 UTSW 18 58061647 missense possibly damaging 0.88
R8801:Fbn2 UTSW 18 58153949 missense probably damaging 1.00
R8857:Fbn2 UTSW 18 58153861 missense probably damaging 1.00
R8878:Fbn2 UTSW 18 58124246 missense probably benign 0.30
R8909:Fbn2 UTSW 18 58059436 missense possibly damaging 0.88
R8973:Fbn2 UTSW 18 58153856 missense probably damaging 1.00
R8979:Fbn2 UTSW 18 58153856 missense probably damaging 1.00
R8991:Fbn2 UTSW 18 58106323 missense probably damaging 1.00
R9003:Fbn2 UTSW 18 58043519 missense probably damaging 1.00
R9205:Fbn2 UTSW 18 58059356 missense probably damaging 1.00
R9215:Fbn2 UTSW 18 58076675 missense probably damaging 1.00
R9263:Fbn2 UTSW 18 58124272 missense probably damaging 1.00
R9307:Fbn2 UTSW 18 58209784 missense probably benign
R9337:Fbn2 UTSW 18 58209651 missense probably benign
R9403:Fbn2 UTSW 18 58066107 missense probably damaging 1.00
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58010379 missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58055482 missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58069190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTCTGAGCAGGATCTG -3'
(R):5'- TGCTCAGAAGTAAGAGTTTCAGG -3'

Sequencing Primer
(F):5'- CAGGATCTGCTGTTGCCATG -3'
(R):5'- CAGAAGTAAGAGTTTCAGGTTTTTGC -3'
Posted On 2021-10-11