Incidental Mutation 'R5438:Ptger2'
ID428489
Institutional Source Beutler Lab
Gene Symbol Ptger2
Ensembl Gene ENSMUSG00000037759
Gene Nameprostaglandin E receptor 2 (subtype EP2)
SynonymsEP2 receptor, Ptgerep2, EP2
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location44988195-45003820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44989644 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 227 (H227L)
Ref Sequence ENSEMBL: ENSMUSP00000038483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046891
AA Change: H227L

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038483
Gene: ENSMUSG00000037759
AA Change: H227L

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Pfam:7tm_1 57 315 5e-26 PFAM
Pfam:7TM_GPCR_Srx 65 243 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 66 319 1.2e-7 PFAM
low complexity region 338 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228945
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for one targeted null mutation exhibit increased blood pressure when fed a high-salt diet. Female mutants for 2 null alleles have small litters due to impaired ovulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Kcnn3 T A 3: 89,521,298 L277Q probably damaging Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Ptger2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ptger2 APN 14 45001741 splice site probably benign
IGL03127:Ptger2 APN 14 45002005 utr 3 prime probably benign
R0533:Ptger2 UTSW 14 44988982 missense possibly damaging 0.90
R0720:Ptger2 UTSW 14 44989133 missense probably benign
R0973:Ptger2 UTSW 14 44989500 missense probably damaging 1.00
R1643:Ptger2 UTSW 14 44988966 start codon destroyed probably null 0.98
R1737:Ptger2 UTSW 14 45001771 missense probably benign 0.04
R2281:Ptger2 UTSW 14 44989650 missense probably damaging 1.00
R3846:Ptger2 UTSW 14 44989327 missense probably damaging 1.00
R4623:Ptger2 UTSW 14 44989014 missense possibly damaging 0.91
R4735:Ptger2 UTSW 14 45001838 missense possibly damaging 0.89
R5001:Ptger2 UTSW 14 44989367 missense probably damaging 1.00
R5613:Ptger2 UTSW 14 44989503 missense possibly damaging 0.88
R5767:Ptger2 UTSW 14 44989142 missense probably benign 0.01
R7405:Ptger2 UTSW 14 44989074 missense probably damaging 1.00
Z1177:Ptger2 UTSW 14 44989021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTACAGGCGCCACTTATC -3'
(R):5'- CTTACTGTGAAAGGCAAGGAGC -3'

Sequencing Primer
(F):5'- CTGCCTGTCATCTATGGGGC -3'
(R):5'- CATATGGCGAAGGTGATGGTC -3'
Posted On2016-09-01