Mutagenetix > Incidental Mutation

Incidental Mutation 'R5438:Grin2b'

428471

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b

MMRRC Submission

043003-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5438 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135690231-136150509 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135713304 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 859 (G859D)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: G859D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: G859D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: G859D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: G859D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158638

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts17	C	A	7: 66,538,165 (GRCm39)	Q244K	probably benign	Het
Arpc2	T	A	1: 74,275,995 (GRCm39)	L4Q	probably null	Het
Atp7b	C	T	8: 22,504,570 (GRCm39)	V581I	probably benign	Het
Bpifb9b	T	A	2: 154,151,288 (GRCm39)	V3D	possibly damaging	Het
Capn13	A	G	17: 73,633,479 (GRCm39)	F525L	probably benign	Het
Cimip4	T	C	15: 78,263,040 (GRCm39)	T180A	possibly damaging	Het
Cmya5	G	T	13: 93,231,707 (GRCm39)	T1127K	possibly damaging	Het
Col6a4	A	T	9: 105,890,895 (GRCm39)	L1800I	possibly damaging	Het
Cpd	T	A	11: 76,682,792 (GRCm39)	I1076F	possibly damaging	Het
Elp4	A	G	2: 105,734,748 (GRCm39)	F29S	probably damaging	Het
Exosc10	T	A	4: 148,650,799 (GRCm39)	Y448*	probably null	Het
Fam219a	A	G	4: 41,520,302 (GRCm39)	S149P	probably damaging	Het
Gdap2	A	T	3: 100,085,629 (GRCm39)	I184F	probably damaging	Het
Golgb1	A	G	16: 36,720,870 (GRCm39)	N409D	probably benign	Het
Hvcn1	A	G	5: 122,376,527 (GRCm39)	K153R	probably damaging	Het
Ighv3-1	T	A	12: 113,928,089 (GRCm39)	H90L	probably benign	Het
Kcnn3	T	A	3: 89,428,605 (GRCm39)	L277Q	probably damaging	Het
Lama1	T	A	17: 68,107,769 (GRCm39)	S2128T	possibly damaging	Het
Ltbp1	T	A	17: 75,598,321 (GRCm39)	S919T	probably damaging	Het
Mgam	A	G	6: 40,661,455 (GRCm39)	N1163S	probably damaging	Het
Mypn	G	T	10: 62,971,618 (GRCm39)	C807*	probably null	Het
Or52n5	G	A	7: 104,588,344 (GRCm39)	V204I	probably benign	Het
Or5m8	T	C	2: 85,822,925 (GRCm39)	F255L	probably damaging	Het
Otud7a	A	G	7: 63,407,207 (GRCm39)	N62S	unknown	Het
Pcdh18	A	T	3: 49,710,465 (GRCm39)	Y283*	probably null	Het
Ptger2	A	T	14: 45,227,101 (GRCm39)	H227L	possibly damaging	Het
Slc24a5	A	G	2: 124,910,785 (GRCm39)	Y72C	probably damaging	Het
Slc35f2	T	A	9: 53,708,302 (GRCm39)	D98E	probably benign	Het
Smad1	A	T	8: 80,082,949 (GRCm39)	F184I	probably benign	Het
Sncg	C	T	14: 34,095,637 (GRCm39)	V52I	probably benign	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Zc3h11a	C	T	1: 133,568,385 (GRCm39)	R88H	probably damaging	Het
Zfp141	A	G	7: 42,138,894 (GRCm39)	V46A	probably damaging	Het
Zfp472	T	A	17: 33,197,193 (GRCm39)	C423S	probably damaging	Het
Zfp729a	A	T	13: 67,767,705 (GRCm39)	H841Q	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,713,329 (GRCm39)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,710,568 (GRCm39)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,713,361 (GRCm39)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,021,263 (GRCm39)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,710,379 (GRCm39)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,710,738 (GRCm39)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,709,584 (GRCm39)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,713,470 (GRCm39)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,716,088 (GRCm39)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,020,906 (GRCm39)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,900,389 (GRCm39)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,756,367 (GRCm39)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,899,996 (GRCm39)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,716,130 (GRCm39)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,716,113 (GRCm39)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,757,253 (GRCm39)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0164:Grin2b	UTSW	6	135,755,646 (GRCm39)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,756,303 (GRCm39)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,710,927 (GRCm39)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,820,193 (GRCm39)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,021,044 (GRCm39)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,709,730 (GRCm39)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,021,209 (GRCm39)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,710,243 (GRCm39)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,710,894 (GRCm39)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,757,138 (GRCm39)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,755,698 (GRCm39)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,710,180 (GRCm39)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,710,427 (GRCm39)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,717,951 (GRCm39)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,709,453 (GRCm39)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,820,108 (GRCm39)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,900,269 (GRCm39)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,713,433 (GRCm39)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,755,739 (GRCm39)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,710,823 (GRCm39)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,751,870 (GRCm39)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,755,697 (GRCm39)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,710,405 (GRCm39)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,756,393 (GRCm39)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,709,439 (GRCm39)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,900,297 (GRCm39)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,756,340 (GRCm39)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,710,916 (GRCm39)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,021,281 (GRCm39)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,709,366 (GRCm39)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,710,721 (GRCm39)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,900,395 (GRCm39)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,710,085 (GRCm39)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,717,962 (GRCm39)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,713,371 (GRCm39)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,710,942 (GRCm39)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,900,456 (GRCm39)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,749,397 (GRCm39)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,710,025 (GRCm39)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,757,277 (GRCm39)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,717,965 (GRCm39)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,710,342 (GRCm39)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,717,996 (GRCm39)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,709,549 (GRCm39)	missense	probably benign
R6647:Grin2b	UTSW	6	135,710,108 (GRCm39)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,751,826 (GRCm39)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,757,198 (GRCm39)	missense	probably benign
R7033:Grin2b	UTSW	6	135,900,036 (GRCm39)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,757,304 (GRCm39)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,710,474 (GRCm39)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,709,946 (GRCm39)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,757,249 (GRCm39)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,717,947 (GRCm39)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,749,394 (GRCm39)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,756,301 (GRCm39)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,900,362 (GRCm39)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,709,553 (GRCm39)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,755,792 (GRCm39)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,710,225 (GRCm39)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,710,486 (GRCm39)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,709,497 (GRCm39)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,900,074 (GRCm39)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,899,967 (GRCm39)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,710,914 (GRCm39)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,899,985 (GRCm39)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,021,007 (GRCm39)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,756,255 (GRCm39)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,710,399 (GRCm39)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,899,868 (GRCm39)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,021,238 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATTCTCTCACACAGACCCTTGG -3'
(R):5'- CTCGTTCTAGGGGAGATGGAAG -3'

Sequencing Primer
(F):5'- CAAGGCTGAACTGTCCTT -3'
(R):5'- AAGAACTGGAAGCTCTCTGGCTC -3'

Posted On

2016-09-01