Incidental Mutation 'R5520:Ssx2ip'
ID431490
Institutional Source Beutler Lab
Gene Symbol Ssx2ip
Ensembl Gene ENSMUSG00000036825
Gene Namesynovial sarcoma, X 2 interacting protein
SynonymsAdip
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146404642-146440144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146437311 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 548 (R548H)
Ref Sequence ENSEMBL: ENSMUSP00000101759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039021] [ENSMUST00000106149] [ENSMUST00000106151] [ENSMUST00000106153]
Predicted Effect probably benign
Transcript: ENSMUST00000039021
AA Change: R547H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045663
Gene: ENSMUSG00000036825
AA Change: R547H

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106149
AA Change: R547H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101755
Gene: ENSMUSG00000036825
AA Change: R547H

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106151
AA Change: R547H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101757
Gene: ENSMUSG00000036825
AA Change: R547H

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106153
AA Change: R548H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101759
Gene: ENSMUSG00000036825
AA Change: R548H

DomainStartEndE-ValueType
Pfam:ADIP 63 214 1.2e-47 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 410 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
Blast:LPD_N 440 481 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141103
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Ssx2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Ssx2ip APN 3 146436552 missense probably damaging 1.00
IGL01140:Ssx2ip APN 3 146427843 missense probably benign 0.02
IGL01810:Ssx2ip APN 3 146428010 missense probably benign 0.00
R0432:Ssx2ip UTSW 3 146426429 missense probably damaging 1.00
R0903:Ssx2ip UTSW 3 146430977 missense probably benign
R2228:Ssx2ip UTSW 3 146417776 missense probably damaging 0.98
R3151:Ssx2ip UTSW 3 146418383 missense probably benign 0.00
R4348:Ssx2ip UTSW 3 146432490 missense probably benign 0.01
R4446:Ssx2ip UTSW 3 146426431 missense probably benign 0.31
R4796:Ssx2ip UTSW 3 146418359 missense probably benign 0.02
R5054:Ssx2ip UTSW 3 146430917 splice site probably benign
R5338:Ssx2ip UTSW 3 146436541 critical splice acceptor site probably null
R5898:Ssx2ip UTSW 3 146427831 missense possibly damaging 0.94
R6367:Ssx2ip UTSW 3 146419166 missense probably benign 0.16
R6777:Ssx2ip UTSW 3 146438721 missense possibly damaging 0.88
R7082:Ssx2ip UTSW 3 146430948 missense probably benign 0.01
R7239:Ssx2ip UTSW 3 146428016 missense probably damaging 1.00
R7249:Ssx2ip UTSW 3 146426438 missense possibly damaging 0.81
R7772:Ssx2ip UTSW 3 146433130 missense probably damaging 0.99
RF004:Ssx2ip UTSW 3 146426440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATGGCTGATCCTGGTTGG -3'
(R):5'- TGCTGGCAATCTCTGTGCAG -3'

Sequencing Primer
(F):5'- AAATGGCTGATCCTGGTTGGTAATC -3'
(R):5'- GAGTCAACCTAATTTCTTCCCACAG -3'
Posted On2016-10-05