Incidental Mutation 'R5524:Nap1l5'
ID431743
Institutional Source Beutler Lab
Gene Symbol Nap1l5
Ensembl Gene ENSMUSG00000055430
Gene Namenucleosome assembly protein 1-like 5
Synonyms1110020M21Rik
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58905233-58907076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58906778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 64 (V64L)
Ref Sequence ENSEMBL: ENSMUSP00000062780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000059539] [ENSMUST00000204629] [ENSMUST00000205101]
Predicted Effect probably benign
Transcript: ENSMUST00000031823
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041401
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059539
AA Change: V64L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062780
Gene: ENSMUSG00000055430
AA Change: V64L

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Pfam:NAP 66 154 3.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131132
Predicted Effect probably benign
Transcript: ENSMUST00000204629
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205101
SMART Domains Protein: ENSMUSP00000145365
Gene: ENSMUSG00000055430

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 58 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205139
Meta Mutation Damage Score 0.1987 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity to nucleosome assembly factors, but may be localized to the cytoplasm rather than the nucleus. Expression of this gene is downregulated in hepatocellular carcinomas. This gene is located within a differentially methylated region (DMR) and is imprinted and paternally expressed. There is a related pseudogene on chromosome 4. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Nap1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0027:Nap1l5 UTSW 6 58906825 missense probably damaging 1.00
R0685:Nap1l5 UTSW 6 58906772 missense possibly damaging 0.52
R7890:Nap1l5 UTSW 6 58906888 missense probably damaging 1.00
R7896:Nap1l5 UTSW 6 58906520 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTGGCGAAGTTGGGACC -3'
(R):5'- GACCAGCTCTATTGCAGACTGC -3'

Sequencing Primer
(F):5'- AGTTGCGCCAGCTGCAG -3'
(R):5'- TGAGCCGAGCAGTAGCCATG -3'
Posted On2016-10-05