Incidental Mutation 'R5524:Baiap2l1'
ID431741
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene NameBAI1-associated protein 2-like 1
SynonymsIRTKS, 1300006M19Rik
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144264526-144358112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144280949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 276 (T276A)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
PDB Structure
Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055190
AA Change: T276A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: T276A

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129287
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198873
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144285546 nonsense probably null
IGL00789:Baiap2l1 APN 5 144286069 splice site probably null
IGL00922:Baiap2l1 APN 5 144318967 missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144275913 missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144280815 intron probably benign
IGL02748:Baiap2l1 APN 5 144266605 intron probably benign
IGL03348:Baiap2l1 APN 5 144278531 missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144278670 missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144266010 missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144266641 missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144284557 missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144277703 missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144286133 missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144324555 critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144278535 missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144278552 missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144278553 missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144282141 missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144275958 missense probably damaging 1.00
R5586:Baiap2l1 UTSW 5 144282139 missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144265977 missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144282088 missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144286106 missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144285579 missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144275877 missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144324626 missense probably benign 0.03
R7662:Baiap2l1 UTSW 5 144357890 intron probably benign
R7797:Baiap2l1 UTSW 5 144318950 missense probably damaging 1.00
X0022:Baiap2l1 UTSW 5 144278652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATATCACAAACACGCACAT -3'
(R):5'- GCTTAAGAAGGAGCCCACC -3'

Sequencing Primer
(F):5'- TATCACAAACACGCACATAAAAATG -3'
(R):5'- CTTTAATCCCAGCACTAGGGAGG -3'
Posted On2016-10-05