Incidental Mutation 'R5576:Slfn9'
ID437227
Institutional Source Beutler Lab
Gene Symbol Slfn9
Ensembl Gene ENSMUSG00000069793
Gene Nameschlafen 9
Synonyms
MMRRC Submission 043131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5576 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82978390-82991830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82981432 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 826 (M826K)
Ref Sequence ENSEMBL: ENSMUSP00000090515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038211] [ENSMUST00000092840] [ENSMUST00000138797]
Predicted Effect probably benign
Transcript: ENSMUST00000038211
AA Change: M826K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044435
Gene: ENSMUSG00000069793
AA Change: M826K

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AlbA_2 205 343 2.3e-17 PFAM
Pfam:DUF2075 592 766 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092840
AA Change: M826K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090515
Gene: ENSMUSG00000069793
AA Change: M826K

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 1.6e-18 PFAM
Pfam:DUF2075 592 766 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138797
SMART Domains Protein: ENSMUSP00000115273
Gene: ENSMUSG00000069793

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 3.8e-19 PFAM
Pfam:DUF2075 592 642 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183379
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,704 T96I probably benign Het
Add2 G T 6: 86,107,475 probably null Het
Agbl1 C T 7: 76,335,237 T134M probably benign Het
Agfg1 T A 1: 82,870,724 S32T probably benign Het
Ankrd17 A C 5: 90,243,224 S2087A probably benign Het
Apob A T 12: 7,998,662 E1012V probably damaging Het
Baiap2 T A 11: 119,996,911 V297E probably benign Het
BC034090 T G 1: 155,241,468 K301N probably benign Het
Bhlha9 T C 11: 76,672,769 I74T probably damaging Het
Btnl9 T C 11: 49,178,885 H189R probably benign Het
Ccdc122 G A 14: 77,091,877 M123I probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah9 T C 11: 65,834,096 probably null Het
Dnaja2 A T 8: 85,539,404 L351I possibly damaging Het
Efcab6 C A 15: 83,950,000 S469I probably benign Het
Esp15 C A 17: 39,642,673 T17K probably damaging Het
Fads1 A G 19: 10,185,874 T172A probably benign Het
Fbp2 A T 13: 62,837,191 D305E probably benign Het
Golga4 A G 9: 118,553,534 T541A probably benign Het
Herc3 T C 6: 58,888,725 Y768H probably benign Het
Kmt2a A G 9: 44,842,634 V514A possibly damaging Het
Melk A G 4: 44,312,255 E141G probably null Het
Nln A G 13: 104,058,830 Y245H probably damaging Het
Nrap C T 19: 56,321,982 R1563H probably damaging Het
Olfr854 T A 9: 19,567,073 M101L probably benign Het
Olfr907 A C 9: 38,498,908 K80Q probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Pex11g A G 8: 3,465,875 S53P probably damaging Het
Pole A T 5: 110,312,065 K1112* probably null Het
Ppfia4 T G 1: 134,323,050 D184A possibly damaging Het
Rpp30 T A 19: 36,101,851 D216E probably benign Het
Sbno2 C T 10: 80,067,337 A398T probably damaging Het
Sbp T A 17: 23,945,578 S94T probably benign Het
Skp1a T G 11: 52,242,588 D33E possibly damaging Het
Slc17a8 A G 10: 89,597,502 W220R probably damaging Het
Snx2 A G 18: 53,210,750 K322E probably benign Het
Spata32 T A 11: 103,209,827 N38I possibly damaging Het
Sycp1 T C 3: 102,818,902 R969G probably damaging Het
Tcrg-C2 T C 13: 19,305,131 I144V probably benign Het
Trpc1 A G 9: 95,721,324 L385S probably damaging Het
Vmn2r105 C T 17: 20,224,574 probably null Het
Xrcc6 T A 15: 82,022,492 D79E probably damaging Het
Zan A T 5: 137,428,482 C2467* probably null Het
Zfp26 A G 9: 20,437,507 V587A possibly damaging Het
Zfp553 C T 7: 127,236,703 R477C possibly damaging Het
Other mutations in Slfn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slfn9 APN 11 82981371 nonsense probably null
IGL01340:Slfn9 APN 11 82981751 missense probably benign 0.29
IGL01543:Slfn9 APN 11 82987949 missense probably benign
IGL01735:Slfn9 APN 11 82982332 missense probably damaging 1.00
IGL01778:Slfn9 APN 11 82987374 missense probably damaging 0.98
IGL01863:Slfn9 APN 11 82981325 missense probably benign 0.27
IGL01997:Slfn9 APN 11 82987677 missense possibly damaging 0.80
IGL02380:Slfn9 APN 11 82981220 missense probably benign 0.23
IGL02993:Slfn9 APN 11 82981196 missense probably benign 0.18
R1463:Slfn9 UTSW 11 82981698 missense possibly damaging 0.78
R1687:Slfn9 UTSW 11 82982157 missense probably damaging 0.99
R1786:Slfn9 UTSW 11 82981307 missense probably damaging 0.99
R1796:Slfn9 UTSW 11 82981955 missense probably benign 0.00
R1870:Slfn9 UTSW 11 82981576 missense probably benign
R1871:Slfn9 UTSW 11 82981576 missense probably benign
R2004:Slfn9 UTSW 11 82988201 missense probably benign 0.25
R2024:Slfn9 UTSW 11 82981681 missense probably damaging 1.00
R2106:Slfn9 UTSW 11 82987680 missense possibly damaging 0.89
R2140:Slfn9 UTSW 11 82984655 missense possibly damaging 0.76
R3004:Slfn9 UTSW 11 82981764 missense possibly damaging 0.94
R4293:Slfn9 UTSW 11 82982508 missense probably benign 0.01
R4927:Slfn9 UTSW 11 82981390 missense possibly damaging 0.47
R4950:Slfn9 UTSW 11 82981904 missense probably benign
R5471:Slfn9 UTSW 11 82982787 missense possibly damaging 0.85
R5543:Slfn9 UTSW 11 82982381 missense probably damaging 1.00
R5996:Slfn9 UTSW 11 82987484 missense possibly damaging 0.67
R7272:Slfn9 UTSW 11 82981561 missense probably benign 0.36
R7421:Slfn9 UTSW 11 82981371 nonsense probably null
R7421:Slfn9 UTSW 11 82987736 missense probably damaging 0.96
R7498:Slfn9 UTSW 11 82982187 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCCCCTCAGGAGTTGAAAG -3'
(R):5'- AGTGGTCCCAAGGTGTATCAG -3'

Sequencing Primer
(F):5'- CCCCTCAGGAGTTGAAAGATACAG -3'
(R):5'- GTGTATCAGGCACCTATGAGATTAC -3'
Posted On2016-10-26