Incidental Mutation 'R0496:Spout1'
ID43902
Institutional Source Beutler Lab
Gene Symbol Spout1
Ensembl Gene ENSMUSG00000039660
Gene NameSPOUT domain containing methyltransferase 1
SynonymsD2Wsu81e
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30173453-30178459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30174971 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 339 (F339S)
Ref Sequence ENSEMBL: ENSMUSP00000097793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015481] [ENSMUST00000100220]
Predicted Effect probably benign
Transcript: ENSMUST00000015481
SMART Domains Protein: ENSMUSP00000015481
Gene: ENSMUSG00000015337

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 62 N/A INTRINSIC
Endonuclease_NS 74 282 3.07e-79 SMART
NUC 75 282 3.37e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100220
AA Change: F339S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097793
Gene: ENSMUSG00000039660
AA Change: F339S

DomainStartEndE-ValueType
coiled coil region 36 72 N/A INTRINSIC
Pfam:Methyltrn_RNA_3 75 365 2.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146466
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation. Heterozygotes show reduced spontaneous apoptosis of differentiating spermatogonia as well as reduced apoptosis and nuclear DNA fragmentation in splenocytes, thymocytes and MEFs in response to apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Spout1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Spout1 APN 2 30177926 nonsense probably null
IGL02232:Spout1 APN 2 30175254 missense probably damaging 1.00
IGL03141:Spout1 APN 2 30175055 missense probably damaging 1.00
R3847:Spout1 UTSW 2 30177407 unclassified probably null
R3944:Spout1 UTSW 2 30174136 missense probably benign
R4162:Spout1 UTSW 2 30177577 intron probably benign
R4163:Spout1 UTSW 2 30177577 intron probably benign
R4164:Spout1 UTSW 2 30177577 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGGTCCCTCAACCTAAGAACACAG -3'
(R):5'- TGCATCCAGTGGAGCCTTGAAGTC -3'

Sequencing Primer
(F):5'- ggggctggagagatggg -3'
(R):5'- AGCCTTGAAGTCAGTGTCC -3'
Posted On2013-05-29