Incidental Mutation 'R0496:Arhgef40'
ID43969
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 52004907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067549] [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000166169] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208] [ENSMUST00000226522] [ENSMUST00000226527] [ENSMUST00000226554] [ENSMUST00000226605] [ENSMUST00000226964] [ENSMUST00000228051] [ENSMUST00000228162] [ENSMUST00000228580] [ENSMUST00000228747]
Predicted Effect probably benign
Transcript: ENSMUST00000067549
SMART Domains Protein: ENSMUSP00000068184
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093813
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166169
SMART Domains Protein: ENSMUSP00000126854
Gene: ENSMUSG00000049295

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect probably benign
Transcript: ENSMUST00000182667
Predicted Effect probably benign
Transcript: ENSMUST00000182760
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182777
Predicted Effect probably benign
Transcript: ENSMUST00000182828
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182909
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183022
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226474
Predicted Effect probably benign
Transcript: ENSMUST00000226522
Predicted Effect probably benign
Transcript: ENSMUST00000226527
Predicted Effect probably benign
Transcript: ENSMUST00000226554
Predicted Effect probably benign
Transcript: ENSMUST00000226605
Predicted Effect probably benign
Transcript: ENSMUST00000226964
Predicted Effect probably benign
Transcript: ENSMUST00000228051
Predicted Effect probably benign
Transcript: ENSMUST00000228162
Predicted Effect probably benign
Transcript: ENSMUST00000228580
Predicted Effect probably benign
Transcript: ENSMUST00000228747
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 51991797 missense unknown
R7857:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
R7935:Arhgef40 UTSW 14 51991797 missense unknown
R7940:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCACAGCTTCCTGTTGCTATG -3'
(R):5'- AGGGAATCGAGAGCTTAGGTCCTC -3'

Sequencing Primer
(F):5'- TCCTTGCCAGAAGAGCTTG -3'
(R):5'- CGAGAGCTTAGGTCCTCCATTATG -3'
Posted On2013-05-29