Mutagenetix > Incidental Mutation

Incidental Mutation 'R0496:Ap3b1'

43966

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

038692-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R0496 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 94472938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably benign
Transcript: ENSMUST00000022196

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000231916

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,244	K1065E	probably damaging	Het
4932438A13Rik	A	G	3: 36,987,635	T2721A	probably damaging	Het
4933402N03Rik	T	C	7: 131,146,131	N44S	probably benign	Het
Abca13	A	G	11: 9,291,701	D1188G	probably benign	Het
Abcb11	C	T	2: 69,277,884		probably benign	Het
Abcc8	A	T	7: 46,108,820	I1274N	probably damaging	Het
Adamtsl1	G	A	4: 86,341,198	C827Y	probably damaging	Het
Agap3	T	A	5: 24,501,243	V369E	probably damaging	Het
Ankrd13b	G	A	11: 77,473,041	R195C	probably damaging	Het
Arhgef40	A	T	14: 52,004,907		probably benign	Het
Atad5	A	G	11: 80,100,356	I692V	probably benign	Het
Atp5b	G	T	10: 128,086,174	R310L	possibly damaging	Het
AY358078	A	T	14: 51,803,532	M103L	unknown	Het
Bcl9l	T	G	9: 44,509,518	V1370G	probably benign	Het
Bglap3	T	A	3: 88,369,137	Q38L	probably damaging	Het
Cd38	T	C	5: 43,868,891	F6L	probably damaging	Het
Cela3a	A	C	4: 137,404,468	V138G	probably damaging	Het
Clvs1	T	A	4: 9,424,241	I229N	probably damaging	Het
Cpne1	G	A	2: 156,079,419	H16Y	probably damaging	Het
Ctc1	T	C	11: 69,035,507	L1069P	probably damaging	Het
Ctgf	G	T	10: 24,597,515	M317I	possibly damaging	Het
Dgkd	G	A	1: 87,936,900	S996N	probably null	Het
Dnah9	A	T	11: 66,075,135	M1685K	probably null	Het
Dnajb12	C	T	10: 59,879,801	R42*	probably null	Het
Dock5	T	C	14: 67,817,518	Q633R	probably damaging	Het
Dync2h1	A	G	9: 7,155,180	M868T	probably benign	Het
Enpp1	G	T	10: 24,672,052	H208Q	probably benign	Het
Epha7	T	A	4: 28,821,292	D152E	probably damaging	Het
Fancd2	T	C	6: 113,555,130		probably benign	Het
Gart	G	A	16: 91,623,037		probably benign	Het
Gm10964	A	T	3: 103,739,429		probably null	Het
Gm7075	G	T	10: 63,421,602	C46*	probably null	Het
Gpbar1	T	C	1: 74,278,981	F128L	probably benign	Het
Gsx2	T	A	5: 75,077,065	M226K	probably benign	Het
Gucd1	T	C	10: 75,511,266	D50G	possibly damaging	Het
Has1	A	G	17: 17,843,746	Y544H	probably benign	Het
Hc	A	T	2: 35,013,571	Y1024N	probably damaging	Het
Hoxa13	CCG	CCGCG	6: 52,260,635		probably null	Het
Ift122	T	A	6: 115,905,902	H659Q	probably benign	Het
Itga2	T	C	13: 114,853,899	Q902R	probably benign	Het
Itgb2l	T	C	16: 96,434,701	K181E	possibly damaging	Het
Jak3	A	T	8: 71,682,397	H558L	probably damaging	Het
Kcnh8	A	G	17: 52,725,858	T58A	probably benign	Het
Klhl6	GT	G	16: 19,956,966	279	probably null	Het
Krt33a	C	T	11: 100,012,329		probably benign	Het
Magi2	A	T	5: 20,661,359		probably benign	Het
Map4	G	A	9: 110,039,850		probably benign	Het
Map4k4	T	A	1: 40,006,822	S754T	probably damaging	Het
Mapk8ip3	A	G	17: 24,914,450		probably benign	Het
Mib1	A	G	18: 10,804,773	S918G	probably benign	Het
Mipol1	T	A	12: 57,457,177	V377D	probably damaging	Het
Mlh1	T	C	9: 111,241,556	T364A	probably benign	Het
Mta1	C	T	12: 113,131,321	Q400*	probably null	Het
Mthfd1l	C	G	10: 4,090,006	R806G	probably benign	Het
Myh13	C	A	11: 67,348,815	N730K	probably damaging	Het
Myom1	A	G	17: 71,084,306	K937E	probably damaging	Het
Naxd	T	C	8: 11,510,224		probably benign	Het
Negr1	G	T	3: 157,016,267	K159N	probably damaging	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1170	A	T	2: 88,224,155	Y292*	probably null	Het
Olfr137	A	G	17: 38,304,658	S268P	probably damaging	Het
Olfr397	T	C	11: 73,964,880	S91P	probably benign	Het
Olfr584	T	C	7: 103,085,590	I19T	probably damaging	Het
Olfr620	C	T	7: 103,611,997	A119T	probably benign	Het
Pcsk6	G	A	7: 65,927,249	S58N	probably benign	Het
Pdzrn3	G	A	6: 101,150,570	T1045I	possibly damaging	Het
Pitrm1	T	C	13: 6,568,714	L641P	probably damaging	Het
Pkd1l1	G	T	11: 8,929,430	H474N	probably damaging	Het
Pltp	A	G	2: 164,852,461		probably benign	Het
Qtrt1	C	T	9: 21,419,548	T324M	probably benign	Het
Racgap1	A	T	15: 99,639,832		probably benign	Het
Rhbg	A	G	3: 88,254,498	V50A	probably benign	Het
Rnf135	G	A	11: 80,183,950	V12M	probably damaging	Het
Rufy2	T	C	10: 62,993,170	V117A	probably damaging	Het
Safb	A	G	17: 56,605,630	M866V	probably benign	Het
Slc35c2	G	T	2: 165,280,815	T183K	probably damaging	Het
Slc39a7	A	G	17: 34,029,538	L377P	probably damaging	Het
Slit1	G	A	19: 41,608,311		probably benign	Het
Spaca9	G	A	2: 28,693,010	H133Y	probably damaging	Het
Spout1	A	G	2: 30,174,971	F339S	probably benign	Het
St6gal2	A	G	17: 55,482,014	I16M	probably damaging	Het
Stat2	T	C	10: 128,276,509	M6T	probably benign	Het
Swt1	T	A	1: 151,411,270	H157L	probably benign	Het
Syne2	A	G	12: 76,038,940	N147D	possibly damaging	Het
Tmem2	A	T	19: 21,797,345	N117I	possibly damaging	Het
Tmem222	A	T	4: 133,277,591	M45K	possibly damaging	Het
Tmem30a	T	A	9: 79,777,285	H95L	probably damaging	Het
Tns3	A	C	11: 8,547,262		probably benign	Het
Trpm3	A	G	19: 22,698,778	I103V	probably benign	Het
Ube2n	T	C	10: 95,541,344	F57S	probably benign	Het
Vil1	T	C	1: 74,421,340	S219P	possibly damaging	Het
Wdfy4	A	G	14: 33,140,738		probably benign	Het
Wdr7	T	C	18: 63,791,843	S966P	probably benign	Het
Wnt8a	A	G	18: 34,544,847	N103D	probably damaging	Het
Zfp523	G	A	17: 28,200,445	E186K	possibly damaging	Het
Zfp791	A	T	8: 85,109,980	D418E	probably benign	Het
Zscan20	A	G	4: 128,591,889	V192A	probably benign	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACAGAAACCATTGAGATTCCGC -3'
(R):5'- GCTCAGTTCCTCTAAGGCAAGGTG -3'

Sequencing Primer
(F):5'- CTGACCTATGAAGAGCTTCCTGG -3'
(R):5'- GGTGTATCTAACACGTTGCATTCAG -3'

Posted On

2013-05-29