Incidental Mutation 'R4164:Spout1'
ID321644
Institutional Source Beutler Lab
Gene Symbol Spout1
Ensembl Gene ENSMUSG00000039660
Gene NameSPOUT domain containing methyltransferase 1
SynonymsD2Wsu81e
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30173453-30178459 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 30177577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015481] [ENSMUST00000100220]
Predicted Effect probably benign
Transcript: ENSMUST00000015481
SMART Domains Protein: ENSMUSP00000015481
Gene: ENSMUSG00000015337

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 62 N/A INTRINSIC
Endonuclease_NS 74 282 3.07e-79 SMART
NUC 75 282 3.37e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100220
SMART Domains Protein: ENSMUSP00000097793
Gene: ENSMUSG00000039660

DomainStartEndE-ValueType
coiled coil region 36 72 N/A INTRINSIC
Pfam:Methyltrn_RNA_3 75 365 2.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146466
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation. Heterozygotes show reduced spontaneous apoptosis of differentiating spermatogonia as well as reduced apoptosis and nuclear DNA fragmentation in splenocytes, thymocytes and MEFs in response to apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Spout1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Spout1 APN 2 30177926 nonsense probably null
IGL02232:Spout1 APN 2 30175254 missense probably damaging 1.00
IGL03141:Spout1 APN 2 30175055 missense probably damaging 1.00
R0496:Spout1 UTSW 2 30174971 missense probably benign 0.00
R3847:Spout1 UTSW 2 30177407 unclassified probably null
R3944:Spout1 UTSW 2 30174136 missense probably benign
R4162:Spout1 UTSW 2 30177577 intron probably benign
R4163:Spout1 UTSW 2 30177577 intron probably benign
R7922:Spout1 UTSW 2 30176811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCACACAGAAGATGGTGC -3'
(R):5'- GAACTCTCCTCCCCATGTCAAG -3'

Sequencing Primer
(F):5'- AAGATGGTGCAGGCTCTGGC -3'
(R):5'- GTCAAGTCCTTTCCCTCCAATAATTC -3'
Posted On2015-06-12