Incidental Mutation 'R5670:Ddb2'
ID442553
Institutional Source Beutler Lab
Gene Symbol Ddb2
Ensembl Gene ENSMUSG00000002109
Gene Namedamage specific DNA binding protein 2
Synonyms2610043A19Rik, p48
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91211572-91236982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91212581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 353 (V353M)
Ref Sequence ENSEMBL: ENSMUSP00000028696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002172] [ENSMUST00000028696] [ENSMUST00000111352] [ENSMUST00000150403]
Predicted Effect probably benign
Transcript: ENSMUST00000002172
SMART Domains Protein: ENSMUSP00000002172
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 54 330 1.5e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028696
AA Change: V353M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109
AA Change: V353M

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111352
AA Change: V217M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109
AA Change: V217M

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135927
Predicted Effect probably benign
Transcript: ENSMUST00000150403
SMART Domains Protein: ENSMUSP00000119144
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 159 4e-35 PFAM
Pfam:His_Phos_2 147 297 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152277
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutant mice are prone to both spontaneous and UV-induced skin cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Ddb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0054:Ddb2 UTSW 2 91234820 missense probably benign 0.14
R0054:Ddb2 UTSW 2 91234820 missense probably benign 0.14
R1537:Ddb2 UTSW 2 91234889 missense probably benign
R1679:Ddb2 UTSW 2 91234250 missense probably benign 0.00
R1707:Ddb2 UTSW 2 91234209 missense probably damaging 1.00
R2858:Ddb2 UTSW 2 91216677 missense probably damaging 1.00
R4797:Ddb2 UTSW 2 91236818 utr 5 prime probably benign
R4985:Ddb2 UTSW 2 91212298 unclassified probably null
R5256:Ddb2 UTSW 2 91236728 missense probably damaging 0.98
R5666:Ddb2 UTSW 2 91212581 missense probably damaging 1.00
R5768:Ddb2 UTSW 2 91211992 missense possibly damaging 0.67
R7324:Ddb2 UTSW 2 91236884 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGAAATTCCCTGCTTCCTC -3'
(R):5'- TATAGGTGCTCTGCCACAGAAC -3'

Sequencing Primer
(F):5'- CTCCCATCACTGTTTGGGGG -3'
(R):5'- ATAGCTAGCAAGTTCTGGGCATCC -3'
Posted On2016-11-09