Incidental Mutation 'R5670:Tm4sf1'
ID442558
Institutional Source Beutler Lab
Gene Symbol Tm4sf1
Ensembl Gene ENSMUSG00000027800
Gene Nametransmembrane 4 superfamily member 1
SynonymsL6, 12A8 target antigen, L6 antigen, M3s1
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location57285611-57301988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57293087 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 65 (F65I)
Ref Sequence ENSEMBL: ENSMUSP00000143652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029376] [ENSMUST00000171384] [ENSMUST00000196506] [ENSMUST00000196979]
Predicted Effect probably benign
Transcript: ENSMUST00000029376
AA Change: F65I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029376
Gene: ENSMUSG00000027800
AA Change: F65I

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171384
AA Change: F65I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130999
Gene: ENSMUSG00000027800
AA Change: F65I

DomainStartEndE-ValueType
Pfam:L6_membrane 1 195 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196506
AA Change: F65I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143697
Gene: ENSMUSG00000027800
AA Change: F65I

DomainStartEndE-ValueType
Pfam:L6_membrane 1 137 3.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196704
Predicted Effect probably benign
Transcript: ENSMUST00000196979
AA Change: F65I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143652
Gene: ENSMUSG00000027800
AA Change: F65I

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198030
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface antigen and is highly expressed in different carcinomas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P probably damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Tm4sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Tm4sf1 APN 3 57293078 missense possibly damaging 0.87
IGL03247:Tm4sf1 APN 3 57293015 missense possibly damaging 0.70
IGL02988:Tm4sf1 UTSW 3 57293116 splice site probably null
R0195:Tm4sf1 UTSW 3 57293059 missense probably damaging 1.00
R1710:Tm4sf1 UTSW 3 57292883 missense probably damaging 1.00
R4573:Tm4sf1 UTSW 3 57294785 missense possibly damaging 0.78
R4801:Tm4sf1 UTSW 3 57294679 missense probably damaging 1.00
R4802:Tm4sf1 UTSW 3 57294679 missense probably damaging 1.00
R4917:Tm4sf1 UTSW 3 57293027 missense probably damaging 1.00
R4918:Tm4sf1 UTSW 3 57293027 missense probably damaging 1.00
R5127:Tm4sf1 UTSW 3 57292868 missense possibly damaging 0.79
R5946:Tm4sf1 UTSW 3 57292868 missense possibly damaging 0.79
R6905:Tm4sf1 UTSW 3 57294909 start gained probably benign
R7334:Tm4sf1 UTSW 3 57293089 missense probably damaging 1.00
R7508:Tm4sf1 UTSW 3 57294755 missense probably benign
R8013:Tm4sf1 UTSW 3 57292898 missense probably benign 0.04
R8014:Tm4sf1 UTSW 3 57292898 missense probably benign 0.04
R8024:Tm4sf1 UTSW 3 57287765 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGATTCCAATCAGAGCAGC -3'
(R):5'- GTGTGCTCACTCACTGTACATG -3'

Sequencing Primer
(F):5'- GATTCCAATCAGAGCAGCCAGTAC -3'
(R):5'- TGCTCACTCACTGTACATGGAAGC -3'
Posted On2016-11-09