Incidental Mutation 'R5680:Gm765'
ID442974
Institutional Source Beutler Lab
Gene Symbol Gm765
Ensembl Gene ENSMUSG00000090667
Gene Namepredicted gene 765
SynonymsLOC330390
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location98235708-98342754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98248226 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 32 (Q32L)
Ref Sequence ENSEMBL: ENSMUSP00000127120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164491]
Predicted Effect probably damaging
Transcript: ENSMUST00000164491
AA Change: Q32L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127120
Gene: ENSMUSG00000090667
AA Change: Q32L

DomainStartEndE-ValueType
Pfam:MDFI 13 189 1.8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205146
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Gm765
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Gm765 APN 6 98248098 missense possibly damaging 0.81
IGL02217:Gm765 APN 6 98248072 missense possibly damaging 0.93
R0508:Gm765 UTSW 6 98238044 utr 3 prime probably benign
R1375:Gm765 UTSW 6 98238299 missense possibly damaging 0.77
R1694:Gm765 UTSW 6 98238139 missense probably damaging 0.98
R1944:Gm765 UTSW 6 98248190 missense probably benign 0.01
R4906:Gm765 UTSW 6 98238119 missense probably damaging 1.00
R5472:Gm765 UTSW 6 98238276 missense probably damaging 1.00
R6285:Gm765 UTSW 6 98238173 missense probably damaging 1.00
R6692:Gm765 UTSW 6 98248208 missense possibly damaging 0.94
R7354:Gm765 UTSW 6 98238281 missense probably damaging 0.97
Z1177:Gm765 UTSW 6 98238240 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGGGAAATTTCGTTTGGCATTC -3'
(R):5'- GGTTTGCCCAACTCACCATC -3'

Sequencing Primer
(F):5'- GAAATTTCGTTTGGCATTCTTCAAGG -3'
(R):5'- ACTCACCATCTTAAAAACTGATGTAG -3'
Posted On2016-11-09