Incidental Mutation 'R5680:Pa2g4'
ID442986
Institutional Source Beutler Lab
Gene Symbol Pa2g4
Ensembl Gene ENSMUSG00000025364
Gene Nameproliferation-associated 2G4
SynonymsPlfap, Ebp1
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128557766-128565987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128559457 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 306 (N306K)
Ref Sequence ENSEMBL: ENSMUSP00000114434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000131728]
Predicted Effect probably benign
Transcript: ENSMUST00000026425
AA Change: N306K

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364
AA Change: N306K

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
AA Change: N306K

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364
AA Change: N306K

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197964
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased body size and weight during early adulthood and produce smaller than normal litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Pa2g4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Pa2g4 APN 10 128559060 critical splice donor site probably null
IGL03198:Pa2g4 APN 10 128565778 missense probably damaging 1.00
IGL03297:Pa2g4 APN 10 128563236 missense probably damaging 1.00
R0238:Pa2g4 UTSW 10 128563642 missense probably benign
R0238:Pa2g4 UTSW 10 128563642 missense probably benign
R1326:Pa2g4 UTSW 10 128559273 missense probably benign 0.06
R3620:Pa2g4 UTSW 10 128563595 missense probably damaging 1.00
R4820:Pa2g4 UTSW 10 128559330 missense probably damaging 1.00
R7069:Pa2g4 UTSW 10 128560690 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTCAGACTTGTACAGGTCAGG -3'
(R):5'- GAACCAGCTTCACACGGTTG -3'

Sequencing Primer
(F):5'- GCTCAAAGGGACCACTGGTTATC -3'
(R):5'- TCACACGGTTGCCCCCTG -3'
Posted On2016-11-09