Incidental Mutation 'R5680:Mark1'
ID442958
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene NameMAP/microtubule affinity regulating kinase 1
SynonymsEmk3, B930025N23Rik
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location184896789-184999570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 184944816 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 79 (H79R)
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929] [ENSMUST00000192657]
Predicted Effect probably damaging
Transcript: ENSMUST00000027929
AA Change: H79R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620
AA Change: H79R

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192657
SMART Domains Protein: ENSMUSP00000142314
Gene: ENSMUSG00000026620

DomainStartEndE-ValueType
S_TKc 1 152 3.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192968
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184898603 missense probably damaging 1.00
IGL00674:Mark1 APN 1 184912106 missense probably benign
IGL01903:Mark1 APN 1 184929380 splice site probably benign
IGL02004:Mark1 APN 1 184912589 missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184944907 missense probably damaging 1.00
IGL03189:Mark1 APN 1 184919693 missense probably damaging 0.96
IGL03391:Mark1 APN 1 184919435 unclassified probably benign
R0277:Mark1 UTSW 1 184944952 missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184921608 missense probably damaging 1.00
R0973:Mark1 UTSW 1 184921604 missense probably damaging 1.00
R1331:Mark1 UTSW 1 184928048 missense probably damaging 1.00
R2061:Mark1 UTSW 1 184928063 missense probably damaging 1.00
R2136:Mark1 UTSW 1 184919573 missense probably damaging 1.00
R2306:Mark1 UTSW 1 184900861 splice site probably benign
R3159:Mark1 UTSW 1 184908387 missense probably damaging 1.00
R3905:Mark1 UTSW 1 184908435 splice site probably null
R4321:Mark1 UTSW 1 184898674 missense possibly damaging 0.46
R4512:Mark1 UTSW 1 184907089 missense probably benign 0.21
R4715:Mark1 UTSW 1 184912132 missense probably benign 0.00
R4829:Mark1 UTSW 1 184905527 missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184905610 missense probably damaging 0.98
R5222:Mark1 UTSW 1 184928091 missense probably damaging 1.00
R6582:Mark1 UTSW 1 184912589 missense possibly damaging 0.82
R6943:Mark1 UTSW 1 184898787 missense probably damaging 1.00
R6979:Mark1 UTSW 1 184912628 missense possibly damaging 0.77
R7031:Mark1 UTSW 1 184912632 missense possibly damaging 0.82
R7455:Mark1 UTSW 1 184919750 missense probably damaging 0.99
R7470:Mark1 UTSW 1 184928044 nonsense probably null
R7715:Mark1 UTSW 1 184907234 missense probably damaging 0.98
R8193:Mark1 UTSW 1 184928052 missense probably damaging 0.99
R8474:Mark1 UTSW 1 184919586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGCCAGTCTTTCCTTAG -3'
(R):5'- CTAGCATACGTCTGTGGATGG -3'

Sequencing Primer
(F):5'- GGTTCATTAGTTCTGCCACAAAACAG -3'
(R):5'- TCTGTGGATGGCTACACTGAAACAC -3'
Posted On2016-11-09