Incidental Mutation 'R5687:Lrrc47'
ID443418
Institutional Source Beutler Lab
Gene Symbol Lrrc47
Ensembl Gene ENSMUSG00000029028
Gene Nameleucine rich repeat containing 47
Synonyms
MMRRC Submission 043320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154011731-154021513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154015683 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 239 (T239A)
Ref Sequence ENSEMBL: ENSMUSP00000133124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030894] [ENSMUST00000143047] [ENSMUST00000169622] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably benign
Transcript: ENSMUST00000030894
AA Change: T217A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030894
Gene: ENSMUSG00000029028
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 10 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
LRR_TYP 100 123 2.61e-4 SMART
LRR_TYP 130 153 2.12e-4 SMART
LRR 155 177 3.75e0 SMART
LRR 180 202 9.77e1 SMART
LRR_TYP 203 226 2.27e-4 SMART
low complexity region 261 272 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
B3_4 331 507 8.94e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142794
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163672
Predicted Effect probably benign
Transcript: ENSMUST00000167947
SMART Domains Protein: ENSMUSP00000131382
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
Pfam:B3_4 1 54 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169622
AA Change: T239A

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133124
Gene: ENSMUSG00000029028
AA Change: T239A

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
low complexity region 32 58 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
LRR_TYP 122 145 2.61e-4 SMART
LRR_TYP 152 175 2.12e-4 SMART
LRR 177 199 3.75e0 SMART
LRR 202 224 9.77e1 SMART
LRR_TYP 225 248 2.27e-4 SMART
low complexity region 283 294 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
B3_4 353 529 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zc3h13 A T 14: 75,331,960 R1416* probably null Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Lrrc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc47 APN 4 154016014 missense probably benign 0.01
IGL02614:Lrrc47 APN 4 154018935 unclassified probably null
IGL03001:Lrrc47 APN 4 154015993 missense probably damaging 0.99
R0372:Lrrc47 UTSW 4 154019632 missense probably benign 0.00
R0433:Lrrc47 UTSW 4 154018365 unclassified probably benign
R0720:Lrrc47 UTSW 4 154019887 intron probably null
R1163:Lrrc47 UTSW 4 154011817 start codon destroyed probably null
R2078:Lrrc47 UTSW 4 154019431 missense probably damaging 1.00
R2103:Lrrc47 UTSW 4 154015893 missense probably damaging 1.00
R5105:Lrrc47 UTSW 4 154012216 missense probably damaging 1.00
R5109:Lrrc47 UTSW 4 154017476 missense probably damaging 0.99
R5885:Lrrc47 UTSW 4 154015972 missense possibly damaging 0.75
R6198:Lrrc47 UTSW 4 154015672 missense probably damaging 1.00
R6384:Lrrc47 UTSW 4 154015860 missense probably benign 0.00
R7040:Lrrc47 UTSW 4 154020452 makesense probably null
R7680:Lrrc47 UTSW 4 154016101 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCAAGTAACCAGTGGGC -3'
(R):5'- CAAGACCTTGAGCATCAGCC -3'

Sequencing Primer
(F):5'- TAACCAGTGGGCAGGCCTG -3'
(R):5'- AGCCTGGCTGAGTCTGCTAC -3'
Posted On2016-11-09