Incidental Mutation 'R5687:Zc3h13'
ID443457
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Namezinc finger CCCH type containing 13
Synonyms4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618
MMRRC Submission 043320-MU
Accession Numbers

Genbank: NM_026083

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5687 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75284373-75344426 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75331960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1416 (R1416*)
Ref Sequence ENSEMBL: ENSMUSP00000153882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect probably null
Transcript: ENSMUST00000022577
AA Change: R1416*
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: R1416*

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000227049
AA Change: R1416*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,325,971 D1292V probably benign Het
Adcy2 A T 13: 68,620,819 C1063* probably null Het
Adcy2 A T 13: 68,642,569 V892D probably damaging Het
Agtpbp1 T C 13: 59,500,515 D497G probably benign Het
Anks1b A C 10: 90,914,711 I195L probably benign Het
Asmt G T X: 170,678,016 S377I unknown Het
C1s1 T A 6: 124,540,950 T24S probably benign Het
Ccdc85a A T 11: 28,392,854 probably benign Het
Ccndbp1 T C 2: 121,014,702 probably benign Het
Cct8 T C 16: 87,488,821 I250V probably benign Het
Cmya5 T C 13: 93,098,176 T135A possibly damaging Het
Col11a1 T C 3: 114,217,103 probably benign Het
Crybg3 A G 16: 59,559,166 M575T probably benign Het
Dmp1 C T 5: 104,207,086 probably benign Het
Emc1 G T 4: 139,375,380 R950L probably damaging Het
Enpep T C 3: 129,299,094 probably null Het
Eya1 G A 1: 14,183,252 T500I probably damaging Het
Fam169a T C 13: 97,093,618 F54L probably damaging Het
Fbxo8 A G 8: 56,591,517 K285R probably damaging Het
Galnt1 A T 18: 24,272,750 E416D probably benign Het
Gcc1 T A 6: 28,419,233 probably null Het
Gm10800 T A 2: 98,666,620 Y196F probably benign Het
Gmpr T A 13: 45,539,020 probably null Het
Jrkl C T 9: 13,244,382 E425K probably benign Het
Kl T G 5: 150,988,466 I560S possibly damaging Het
Kyat3 C A 3: 142,734,582 R356S probably null Het
Lrig2 C T 3: 104,464,072 probably null Het
Lrrc47 A G 4: 154,015,683 T239A probably benign Het
Map4k2 T C 19: 6,345,642 probably benign Het
Mon2 A G 10: 123,008,239 S1469P probably damaging Het
Mthfd1l G A 10: 3,990,002 probably null Het
Mvk G T 5: 114,450,765 G144V probably damaging Het
Nasp T A 4: 116,605,805 probably benign Het
Ndst4 A C 3: 125,438,609 N276H possibly damaging Het
Nsmf C T 2: 25,056,067 P189S probably damaging Het
Nt5m T G 11: 59,852,823 D92E probably benign Het
Olfr1198 A T 2: 88,746,750 I46N probably damaging Het
Olfr1285 T C 2: 111,408,688 noncoding transcript Het
Olfr981 T G 9: 40,022,435 L14R probably damaging Het
Pan3 T A 5: 147,455,172 I119N probably damaging Het
Pard6b A T 2: 168,098,626 S178C probably damaging Het
Parl A G 16: 20,287,978 probably benign Het
Pdk2 A G 11: 95,029,025 probably benign Het
Prag1 A G 8: 36,146,813 E1173G probably benign Het
Prph2 T A 17: 46,923,465 L320Q probably damaging Het
Psmd3 T C 11: 98,693,669 I200T probably damaging Het
Rhbdd3 T A 11: 5,105,707 S324T probably damaging Het
Rps6-ps2 A T 8: 88,806,484 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Samd4 A G 14: 47,016,565 N61S probably benign Het
Sfrp2 G A 3: 83,766,839 A100T probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a13 A G 6: 121,302,741 T25A probably benign Het
Sntg1 C A 1: 8,463,443 R329L possibly damaging Het
Sorbs2 T C 8: 45,775,632 F285L probably damaging Het
Speg T C 1: 75,419,129 probably null Het
Srgap1 T C 10: 121,825,636 Y533C probably damaging Het
Supt5 C A 7: 28,317,763 S668I probably benign Het
Taf6l T G 19: 8,773,312 I133L probably benign Het
Tcrg-C1 A T 13: 19,216,559 I153F unknown Het
Thrap3 G A 4: 126,180,486 probably benign Het
Tmem115 A G 9: 107,534,855 N126S probably benign Het
Tspoap1 T A 11: 87,777,126 I1192N probably damaging Het
Vcan T C 13: 89,678,134 I3184V probably damaging Het
Yeats4 G A 10: 117,215,680 T224M probably benign Het
Zmynd12 T A 4: 119,441,901 Y193N probably damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75330147 missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75335999 missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75309723 missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75343769 utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75330347 missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75331766 missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75293941 missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75293976 missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75316039 missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75323603 small insertion probably benign
FR4304:Zc3h13 UTSW 14 75323610 small insertion probably benign
FR4340:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4449:Zc3h13 UTSW 14 75323601 nonsense probably null
FR4548:Zc3h13 UTSW 14 75323599 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323597 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323598 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323596 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323599 small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75331883 missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75323254 missense unknown
R0374:Zc3h13 UTSW 14 75308965 missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75323482 missense unknown
R0408:Zc3h13 UTSW 14 75292186 nonsense probably null
R0967:Zc3h13 UTSW 14 75343739 missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75330549 missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75315984 missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75337483 nonsense probably null
R2021:Zc3h13 UTSW 14 75330195 missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75332147 missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75308940 nonsense probably null
R3745:Zc3h13 UTSW 14 75330661 missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75329738 missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75327601 missense unknown
R4799:Zc3h13 UTSW 14 75339423 missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75339396 missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75336009 missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75343619 missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75331247 missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75330908 missense probably benign 0.10
R5726:Zc3h13 UTSW 14 75330829 missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75328132 missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75330709 missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75337409 missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75343736 missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75330423 missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75308915 missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75323558 small deletion probably benign
R6598:Zc3h13 UTSW 14 75332183 missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75331157 missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75321787 missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75321721 missense unknown
R7307:Zc3h13 UTSW 14 75330541 missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75308909 missense unknown
R7680:Zc3h13 UTSW 14 75330515 missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75330630 missense not run
R8048:Zc3h13 UTSW 14 75324537 missense unknown
R8059:Zc3h13 UTSW 14 75327810 missense unknown
R8362:Zc3h13 UTSW 14 75324469 missense unknown
R8391:Zc3h13 UTSW 14 75331185 missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75332072 missense probably benign 0.05
Z1177:Zc3h13 UTSW 14 75328065 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCGTTTGACAGTAGAGACCGAC -3'
(R):5'- TTCAAATCCCTGCACAGAGC -3'

Sequencing Primer
(F):5'- TTTGACAGTAGAGACCGACTTCAAG -3'
(R):5'- TCTTTGTCCAAGGCCACGGAG -3'
Posted On2016-11-09