Incidental Mutation 'R5740:Ncbp3'
ID444755
Institutional Source Beutler Lab
Gene Symbol Ncbp3
Ensembl Gene ENSMUSG00000020783
Gene Namenuclear cap binding subunit 3
Synonyms1200014J11Rik
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73047783-73089317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73053497 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 108 (N108K)
Ref Sequence ENSEMBL: ENSMUSP00000021135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021135
AA Change: N108K

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021135
Gene: ENSMUSG00000020783
AA Change: N108K

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 33 52 N/A INTRINSIC
Pfam:DUF2414 123 177 4.5e-24 PFAM
low complexity region 191 231 N/A INTRINSIC
coiled coil region 345 364 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 602 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151823
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in Ncbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ncbp3 APN 11 73073529 splice site probably benign
R0180:Ncbp3 UTSW 11 73064978 splice site probably null
R0464:Ncbp3 UTSW 11 73069821 splice site probably benign
R0620:Ncbp3 UTSW 11 73049845 splice site probably benign
R2024:Ncbp3 UTSW 11 73053520 missense possibly damaging 0.95
R2121:Ncbp3 UTSW 11 73053478 missense possibly damaging 0.56
R4610:Ncbp3 UTSW 11 73079018 missense probably damaging 0.98
R4693:Ncbp3 UTSW 11 73075677 missense probably benign 0.00
R4883:Ncbp3 UTSW 11 73069752 missense probably damaging 0.99
R4974:Ncbp3 UTSW 11 73053529 critical splice donor site probably null
R5212:Ncbp3 UTSW 11 73053547 intron probably benign
R5906:Ncbp3 UTSW 11 73073501 missense probably benign 0.04
R6026:Ncbp3 UTSW 11 73067722 missense probably benign 0.00
R6154:Ncbp3 UTSW 11 73049874 missense probably damaging 1.00
R6403:Ncbp3 UTSW 11 73078976 missense probably benign 0.00
R6626:Ncbp3 UTSW 11 73073384 missense possibly damaging 0.88
R6838:Ncbp3 UTSW 11 73073474 missense possibly damaging 0.89
R7155:Ncbp3 UTSW 11 73048009 missense probably damaging 0.99
R7369:Ncbp3 UTSW 11 73077921 missense probably benign 0.00
R7587:Ncbp3 UTSW 11 73066765 splice site probably null
R7657:Ncbp3 UTSW 11 73073367 missense probably damaging 1.00
Y5379:Ncbp3 UTSW 11 73073260 small deletion probably benign
Z1177:Ncbp3 UTSW 11 73047968 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAAAACACATTCAAGGTTGC -3'
(R):5'- AGCTCTAACCGAGAACTATCTGAC -3'

Sequencing Primer
(F):5'- ACACATTCAAGGTTGCTTATTGTG -3'
(R):5'- GAGAACTATCTGACAGCGTCTC -3'
Posted On2016-11-21