Incidental Mutation 'R5740:Hivep3'
ID444740
Institutional Source Beutler Lab
Gene Symbol Hivep3
Ensembl Gene ENSMUSG00000028634
Gene Namehuman immunodeficiency virus type I enhancer binding protein 3
SynonymsE030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119733784-120138045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120096023 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 512 (E512G)
Ref Sequence ENSEMBL: ENSMUSP00000130249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542] [ENSMUST00000226560]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106307
AA Change: E512G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: E512G

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166542
AA Change: E512G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: E512G

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226560
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in Hivep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Hivep3 APN 4 120098374 missense probably damaging 1.00
IGL01017:Hivep3 APN 4 120099246 missense probably damaging 0.98
IGL01837:Hivep3 APN 4 120094562 missense possibly damaging 0.72
IGL01878:Hivep3 APN 4 120095227 missense possibly damaging 0.84
IGL02134:Hivep3 APN 4 120133574 splice site probably benign
IGL02183:Hivep3 APN 4 120132024 missense probably benign 0.04
IGL02350:Hivep3 APN 4 120123025 missense probably damaging 1.00
IGL02451:Hivep3 APN 4 120133965 missense probably damaging 1.00
IGL02567:Hivep3 APN 4 120133956 missense probably damaging 0.99
IGL02617:Hivep3 APN 4 120095444 missense probably benign 0.04
IGL02725:Hivep3 APN 4 120095822 missense possibly damaging 0.48
IGL02828:Hivep3 APN 4 120097732 nonsense probably null
IGL02954:Hivep3 APN 4 120133641 missense probably damaging 1.00
IGL02966:Hivep3 APN 4 120132186 missense probably benign 0.04
Deceit UTSW 4 120097911 frame shift probably null
Stealth UTSW 4 120122876 nonsense probably null
PIT4260001:Hivep3 UTSW 4 120099182 missense probably damaging 1.00
R0321:Hivep3 UTSW 4 120095591 missense possibly damaging 0.84
R0336:Hivep3 UTSW 4 120103847 missense probably damaging 1.00
R0558:Hivep3 UTSW 4 120096566 missense probably damaging 0.98
R0562:Hivep3 UTSW 4 120096554 missense probably benign 0.00
R0637:Hivep3 UTSW 4 120132541 nonsense probably null
R0645:Hivep3 UTSW 4 120097334 missense possibly damaging 0.95
R1186:Hivep3 UTSW 4 119814723 start gained probably benign
R1254:Hivep3 UTSW 4 120099293 missense probably damaging 1.00
R1428:Hivep3 UTSW 4 120096575 missense possibly damaging 0.92
R1623:Hivep3 UTSW 4 120095704 missense possibly damaging 0.84
R1739:Hivep3 UTSW 4 120095174 missense probably benign 0.03
R1766:Hivep3 UTSW 4 120096671 missense probably benign
R1769:Hivep3 UTSW 4 120097571 missense possibly damaging 0.68
R1773:Hivep3 UTSW 4 120098837 missense probably damaging 1.00
R1968:Hivep3 UTSW 4 120096238 missense possibly damaging 0.83
R2220:Hivep3 UTSW 4 119734038 missense possibly damaging 0.92
R2428:Hivep3 UTSW 4 120098508 nonsense probably null
R3789:Hivep3 UTSW 4 120098416 missense probably damaging 1.00
R3917:Hivep3 UTSW 4 120099427 missense probably benign 0.27
R4366:Hivep3 UTSW 4 120096089 missense possibly damaging 0.84
R4436:Hivep3 UTSW 4 120095923 missense probably benign 0.11
R4504:Hivep3 UTSW 4 119733793 unclassified probably benign
R4705:Hivep3 UTSW 4 119872050 intron probably benign
R4713:Hivep3 UTSW 4 120131803 missense probably damaging 1.00
R4756:Hivep3 UTSW 4 120097823 missense probably damaging 0.98
R4887:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R4888:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R5008:Hivep3 UTSW 4 120098917 missense probably benign 0.22
R5204:Hivep3 UTSW 4 120103856 critical splice donor site probably null
R5594:Hivep3 UTSW 4 120123048 critical splice donor site probably null
R5697:Hivep3 UTSW 4 120096955 missense possibly damaging 0.68
R5715:Hivep3 UTSW 4 120096373 missense probably benign
R5760:Hivep3 UTSW 4 120095011 missense possibly damaging 0.83
R5923:Hivep3 UTSW 4 120096293 missense possibly damaging 0.92
R5927:Hivep3 UTSW 4 120097108 missense possibly damaging 0.68
R6042:Hivep3 UTSW 4 120097864 missense possibly damaging 0.85
R6074:Hivep3 UTSW 4 120097694 missense possibly damaging 0.68
R6150:Hivep3 UTSW 4 119734077 nonsense probably null
R6211:Hivep3 UTSW 4 120098405 missense probably damaging 1.00
R6251:Hivep3 UTSW 4 120094940 missense probably damaging 0.98
R6451:Hivep3 UTSW 4 120098908 missense probably benign 0.22
R6531:Hivep3 UTSW 4 120122876 nonsense probably null
R6651:Hivep3 UTSW 4 120122949 missense probably damaging 1.00
R6701:Hivep3 UTSW 4 120094540 missense probably damaging 0.97
R6721:Hivep3 UTSW 4 120095099 missense possibly damaging 0.82
R6796:Hivep3 UTSW 4 120096361 missense possibly damaging 0.68
R6864:Hivep3 UTSW 4 120094888 missense possibly damaging 0.48
R6902:Hivep3 UTSW 4 120095995 missense possibly damaging 0.48
R7111:Hivep3 UTSW 4 120095234 missense possibly damaging 0.68
R7113:Hivep3 UTSW 4 120098369 missense probably damaging 1.00
R7140:Hivep3 UTSW 4 120097121 missense probably damaging 0.99
R7189:Hivep3 UTSW 4 120132219 missense probably damaging 0.99
R7218:Hivep3 UTSW 4 120095452 missense possibly damaging 0.92
R7366:Hivep3 UTSW 4 120097911 frame shift probably null
R7368:Hivep3 UTSW 4 120097911 frame shift probably null
R7491:Hivep3 UTSW 4 120098830 missense probably benign 0.09
R7496:Hivep3 UTSW 4 120132402 missense probably benign 0.00
R7514:Hivep3 UTSW 4 120096855 missense possibly damaging 0.48
R7604:Hivep3 UTSW 4 120097911 frame shift probably null
R7605:Hivep3 UTSW 4 120097911 frame shift probably null
R7607:Hivep3 UTSW 4 120097911 frame shift probably null
R7610:Hivep3 UTSW 4 120097911 frame shift probably null
R7611:Hivep3 UTSW 4 120097911 frame shift probably null
R7613:Hivep3 UTSW 4 120097911 frame shift probably null
R7626:Hivep3 UTSW 4 120097911 frame shift probably null
R7707:Hivep3 UTSW 4 119733959 missense
R7736:Hivep3 UTSW 4 120095543 missense possibly damaging 0.92
RF019:Hivep3 UTSW 4 120098270 missense probably benign 0.12
X0062:Hivep3 UTSW 4 120098698 missense probably damaging 1.00
X0067:Hivep3 UTSW 4 120131787 missense probably damaging 0.96
Z1176:Hivep3 UTSW 4 120133782 missense probably damaging 1.00
Z1177:Hivep3 UTSW 4 120095946 missense possibly damaging 0.68
Z1177:Hivep3 UTSW 4 120131778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCCAGGACACAAGTGATC -3'
(R):5'- AATTCAATGGCTGGCTGGCG -3'

Sequencing Primer
(F):5'- GGACACAAGTGATCGAACATATC -3'
(R):5'- TGGCGCTTTAGCATCCG -3'
Posted On2016-11-21