Incidental Mutation 'R5740:F13a1'
ID444757
Institutional Source Beutler Lab
Gene Symbol F13a1
Ensembl Gene ENSMUSG00000039109
Gene Namecoagulation factor XIII, A1 subunit
SynonymsFactor XIIIA, 1200014I03Rik
MMRRC Submission 043196-MU
Accession Numbers

Genbank: NM_028784; MGI: 1921395

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location36867178-37050244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36898204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 509 (T509A)
Ref Sequence ENSEMBL: ENSMUSP00000128316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037491] [ENSMUST00000164727]
Predicted Effect probably benign
Transcript: ENSMUST00000037491
AA Change: T509A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048667
Gene: ENSMUSG00000039109
AA Change: T509A

DomainStartEndE-ValueType
Pfam:Transglut_N 47 165 9e-34 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2e-26 PFAM
Pfam:Transglut_C 631 728 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164727
AA Change: T509A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128316
Gene: ENSMUSG00000039109
AA Change: T509A

DomainStartEndE-ValueType
Pfam:Transglut_N 46 167 3e-38 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2.2e-23 PFAM
Pfam:Transglut_C 631 728 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit A of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit B to form a heterotetrameric proenzyme that undergoes thrombin-mediated proteolysis to generate active factor XIIIa. The transglutaminase activity of factor XIIIa is required for the calcium-dependent crosslinking of fibrin, leading to the formation of a clot. Mice lacking the encoded protein display impaired reproduction and reduced survival due to bleeding episodes, hematothorax, hematoperitoneum and subcutaneous hemorrhage. Additionally, mice lacking the encoded protein exhibit impaired wound healing and inadequate healing of myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice exhibit bleeding symptoms, increased lethality, and impaired fertility. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in F13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:F13a1 APN 13 36988878 missense probably benign 0.11
IGL01444:F13a1 APN 13 36918577 missense probably null 1.00
IGL02188:F13a1 APN 13 36906061 splice site probably benign
IGL02591:F13a1 APN 13 36898057 missense probably damaging 1.00
IGL02660:F13a1 APN 13 36943894 missense possibly damaging 0.92
IGL03244:F13a1 APN 13 36988896 missense possibly damaging 0.82
IGL03401:F13a1 APN 13 36898080 missense probably benign 0.00
F6893:F13a1 UTSW 13 36972025 missense probably damaging 1.00
R0082:F13a1 UTSW 13 36988953 missense probably damaging 0.99
R0657:F13a1 UTSW 13 36968105 missense probably damaging 0.96
R1225:F13a1 UTSW 13 37025851 missense probably benign
R1430:F13a1 UTSW 13 36898131 missense probably damaging 1.00
R1608:F13a1 UTSW 13 36868811 missense probably damaging 1.00
R1883:F13a1 UTSW 13 36989007 missense probably benign 0.01
R2115:F13a1 UTSW 13 36988857 missense probably damaging 1.00
R2121:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2122:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2125:F13a1 UTSW 13 36892841 missense probably benign 0.15
R2392:F13a1 UTSW 13 36943997 missense possibly damaging 0.65
R3618:F13a1 UTSW 13 36943993 missense probably damaging 1.00
R3625:F13a1 UTSW 13 36898093 missense probably benign 0.31
R3772:F13a1 UTSW 13 36898134 missense probably benign
R3838:F13a1 UTSW 13 37047424 missense probably damaging 1.00
R3857:F13a1 UTSW 13 37025694 missense probably benign 0.32
R3937:F13a1 UTSW 13 36916901 missense probably damaging 1.00
R4934:F13a1 UTSW 13 36877762 missense probably benign 0.00
R4974:F13a1 UTSW 13 36916863 critical splice donor site probably null
R5033:F13a1 UTSW 13 36988856 missense probably damaging 1.00
R5194:F13a1 UTSW 13 36972063 missense probably damaging 1.00
R5753:F13a1 UTSW 13 36898108 nonsense probably null
R6188:F13a1 UTSW 13 37025778 missense probably benign 0.12
R7048:F13a1 UTSW 13 36898143 missense probably benign 0.02
R7197:F13a1 UTSW 13 36916886 missense probably damaging 1.00
R7816:F13a1 UTSW 13 37025771 missense probably benign 0.00
Z1088:F13a1 UTSW 13 36989012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGTCTCTTCAAAGGACTC -3'
(R):5'- TACCTTTCTATGCGGGAGAGG -3'

Sequencing Primer
(F):5'- TCAAAGGACTCCTTCTTGAACTC -3'
(R):5'- AGAGGTTGATTGGCTTTCAGAG -3'
Posted On2016-11-21