Incidental Mutation 'R5742:Olfr27'
ID445618
Institutional Source Beutler Lab
Gene Symbol Olfr27
Ensembl Gene ENSMUSG00000049708
Gene Nameolfactory receptor 27
SynonymsMOR171-6, GA_x6K02T2PVTD-32841223-32842158, MTPCR56
MMRRC Submission 043352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39128131-39145072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39144678 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 193 (F193I)
Ref Sequence ENSEMBL: ENSMUSP00000150009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214052] [ENSMUST00000216405]
Predicted Effect probably benign
Transcript: ENSMUST00000057811
AA Change: F193I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110642
Gene: ENSMUSG00000049708
AA Change: F193I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214052
AA Change: F193I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216405
AA Change: F193I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Masp1 T A 16: 23,454,925 M588L probably benign Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Olfr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr27 APN 9 39144757 missense possibly damaging 0.94
IGL00905:Olfr27 APN 9 39145030 missense probably damaging 1.00
IGL02346:Olfr27 APN 9 39144643 missense probably damaging 1.00
R0117:Olfr27 UTSW 9 39144850 missense probably damaging 1.00
R0118:Olfr27 UTSW 9 39144103 start codon destroyed probably null 0.97
R0590:Olfr27 UTSW 9 39144721 missense probably benign 0.01
R2915:Olfr27 UTSW 9 39144466 missense possibly damaging 0.94
R4299:Olfr27 UTSW 9 39144999 missense probably benign 0.11
R4367:Olfr27 UTSW 9 39144429 missense probably damaging 0.98
R4663:Olfr27 UTSW 9 39144849 missense probably damaging 0.97
R5276:Olfr27 UTSW 9 39144315 missense probably damaging 1.00
R5503:Olfr27 UTSW 9 39144484 missense probably benign 0.02
R5986:Olfr27 UTSW 9 39144982 missense probably null 1.00
R6801:Olfr27 UTSW 9 39144210 missense probably benign 0.01
R7247:Olfr27 UTSW 9 39144857 nonsense probably null
R7520:Olfr27 UTSW 9 39144118 missense probably benign
R7787:Olfr27 UTSW 9 39144252 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AACCCCTTGCTTTACAATGTAACC -3'
(R):5'- GTAAGTACGTGAATGCACCAG -3'

Sequencing Primer
(F):5'- TGCTTTACAATGTAACCATGTCC -3'
(R):5'- GTGAATGCACCAGAACCATAAAAG -3'
Posted On2016-11-21