Incidental Mutation 'R5831:Irgq'
ID449313
Institutional Source Beutler Lab
Gene Symbol Irgq
Ensembl Gene ENSMUSG00000041037
Gene Nameimmunity-related GTPase family, Q
SynonymsFKSG27
MMRRC Submission 043220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5831 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24530689-24538600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24533338 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 201 (F201L)
Ref Sequence ENSEMBL: ENSMUSP00000036699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049020]
Predicted Effect probably damaging
Transcript: ENSMUST00000049020
AA Change: F201L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036699
Gene: ENSMUSG00000041037
AA Change: F201L

DomainStartEndE-ValueType
SCOP:d4tmka_ 12 61 7e-3 SMART
low complexity region 64 75 N/A INTRINSIC
low complexity region 92 112 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 409 455 N/A INTRINSIC
low complexity region 520 538 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,567,777 K4460* probably null Het
Adam21 A G 12: 81,559,101 V629A probably benign Het
Adamts5 C T 16: 85,868,118 V653I probably damaging Het
Adarb2 G A 13: 8,559,133 A44T probably benign Het
Ank2 T C 3: 127,339,159 probably benign Het
Arhgap21 T C 2: 20,863,213 Y833C probably damaging Het
Brwd1 A G 16: 96,019,436 S1297P probably damaging Het
Cdc25b G T 2: 131,187,381 probably null Het
Ciart A T 3: 95,878,902 V287D probably damaging Het
Csf2ra A G 19: 61,225,212 F353S probably damaging Het
D630045J12Rik C T 6: 38,142,657 E1717K possibly damaging Het
Dhcr24 A G 4: 106,564,414 K82R probably benign Het
Dnah9 T A 11: 66,108,121 T1034S probably benign Het
Dock6 T C 9: 21,803,036 E1837G probably damaging Het
Fam102b A T 3: 108,992,703 S110T possibly damaging Het
Flg2 G A 3: 93,200,234 V9I probably damaging Het
Hif1a A T 12: 73,942,144 T602S probably benign Het
Hip1 T C 5: 135,411,263 E1015G probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Isoc2b C A 7: 4,851,024 L116F probably null Het
Loxl3 A T 6: 83,049,018 T416S probably benign Het
Map3k13 A G 16: 21,928,048 *960W probably null Het
Morn1 A G 4: 155,101,276 H183R probably benign Het
Mrc1 A T 2: 14,308,712 N918I probably damaging Het
Nfxl1 A G 5: 72,522,197 V763A probably benign Het
Olfr1186 G A 2: 88,526,480 W299* probably null Het
Olfr738 A G 14: 50,413,982 probably null Het
Papola A G 12: 105,823,600 K482E probably benign Het
Pck1 C T 2: 173,156,999 T350I probably damaging Het
Peli2 G A 14: 48,168,270 A51T probably damaging Het
Preb T C 5: 30,958,864 H133R probably benign Het
Rpl36-ps4 T C 17: 87,921,257 V73A probably benign Het
Scaf11 G A 15: 96,417,081 P1240L probably benign Het
Selenom G T 11: 3,516,882 E81* probably null Het
Serpinb1c T C 13: 32,897,098 M1V probably null Het
Tanc1 T C 2: 59,785,341 S231P possibly damaging Het
Trappc10 C T 10: 78,209,426 R476Q probably damaging Het
Twf2 T A 9: 106,214,187 D200E probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn2r71 G A 7: 85,623,714 D579N probably benign Het
Vrtn A T 12: 84,648,575 E33V probably damaging Het
Other mutations in Irgq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Irgq APN 7 24533724 missense probably damaging 1.00
IGL02639:Irgq APN 7 24531462 missense probably damaging 1.00
R4222:Irgq UTSW 7 24533625 missense possibly damaging 0.79
R4806:Irgq UTSW 7 24534045 missense probably damaging 1.00
R5980:Irgq UTSW 7 24533345 missense probably damaging 1.00
R6460:Irgq UTSW 7 24533690 missense probably benign 0.00
R6802:Irgq UTSW 7 24531651 missense probably benign
R7173:Irgq UTSW 7 24533760 missense probably damaging 0.99
R7465:Irgq UTSW 7 24534409 missense probably damaging 0.97
R8409:Irgq UTSW 7 24533784 missense probably benign
Z1176:Irgq UTSW 7 24531801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCTCTTAACTTTATGGTCCCG -3'
(R):5'- CAAGGATCAGGGCATCGTAG -3'

Sequencing Primer
(F):5'- CTGGCCTTGAACTCAGAGATCTG -3'
(R):5'- AACGGTCCAGAGCACTACGTTG -3'
Posted On2016-12-20