Incidental Mutation 'R5708:Olfr290'
ID452082
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission 043333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5708 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84916183 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000149523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073468
AA Change: I135V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: I135V

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173463
Predicted Effect possibly damaging
Transcript: ENSMUST00000214501
AA Change: I135V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216184
AA Change: I135V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216367
AA Change: I135V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,707 M158L probably benign Het
1700067K01Rik A G 8: 84,002,998 K101R probably benign Het
4933430I17Rik T C 4: 62,525,869 S18P probably benign Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aox4 G T 1: 58,245,873 A595S possibly damaging Het
Asxl2 T A 12: 3,500,603 S782T possibly damaging Het
C1s2 A T 6: 124,625,743 L503* probably null Het
C7 A G 15: 5,015,401 V385A possibly damaging Het
Cdh20 T C 1: 104,984,910 F630L probably damaging Het
Cdk14 A C 5: 5,266,036 probably benign Het
Cdkl4 T C 17: 80,539,522 I239M possibly damaging Het
Col11a1 A G 3: 114,097,094 N360S unknown Het
D630003M21Rik A G 2: 158,220,392 probably null Het
Dchs1 G A 7: 105,772,809 P135S probably damaging Het
Dpysl2 A G 14: 66,813,146 S421P probably benign Het
Edn1 A T 13: 42,303,667 M59L probably benign Het
EU599041 A G 7: 43,225,887 noncoding transcript Het
Fam196a C A 7: 134,918,796 V2F probably damaging Het
Furin A G 7: 80,397,855 probably benign Het
Gkn2 T C 6: 87,377,436 L94P probably damaging Het
Gmeb2 A T 2: 181,264,989 C117S probably damaging Het
Greb1 T A 12: 16,673,842 I1869F probably benign Het
Heg1 A G 16: 33,742,404 E1119G probably damaging Het
Hmgcs2 T A 3: 98,291,162 L127Q probably damaging Het
Kcnh6 A G 11: 106,020,256 R493G probably benign Het
Kcnj11 C T 7: 46,099,818 R27H probably benign Het
Klra14-ps A G 6: 130,157,788 noncoding transcript Het
Lgmn A T 12: 102,404,328 N114K possibly damaging Het
Lipg C T 18: 74,955,434 M148I possibly damaging Het
Megf8 G T 7: 25,334,597 R607L probably benign Het
Mks1 A G 11: 87,856,839 T183A probably benign Het
Mllt11 A G 3: 95,220,204 V85A probably benign Het
Mpo A T 11: 87,801,755 probably null Het
Muc4 A T 16: 32,754,769 probably benign Het
Myoz3 T C 18: 60,579,032 Y158C probably damaging Het
Olfr1287 A G 2: 111,450,009 R290G probably damaging Het
Olfr741 A T 14: 50,485,995 D179V probably damaging Het
Polq T A 16: 37,061,018 S902R probably damaging Het
Rarb T C 14: 16,548,545 T93A probably damaging Het
Rgs12 A G 5: 34,966,352 D493G probably benign Het
Sec31b T A 19: 44,523,144 D606V probably damaging Het
Setd2 T C 9: 110,548,823 F569L possibly damaging Het
Sil1 T C 18: 35,341,117 E149G probably benign Het
Spata13 T G 14: 60,692,003 S337A probably damaging Het
Srfbp1 T A 18: 52,488,946 L360M probably damaging Het
Tecta A T 9: 42,338,926 C1852S probably damaging Het
Tgfbr3l A G 8: 4,250,360 T208A probably damaging Het
Tmem38b G C 4: 53,849,051 probably null Het
Tnfrsf11a T A 1: 105,813,820 probably null Het
Tnik T A 3: 28,611,971 probably null Het
Tsc1 A T 2: 28,665,185 probably benign Het
Zfp930 T C 8: 69,226,461 V41A probably benign Het
Zscan18 A T 7: 12,774,456 D372E probably benign Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1652:Olfr290 UTSW 7 84916520 missense probably damaging 1.00
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4822:Olfr290 UTSW 7 84916426 missense possibly damaging 0.81
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5650:Olfr290 UTSW 7 84916418 missense possibly damaging 0.50
R6585:Olfr290 UTSW 7 84916462 missense probably damaging 0.99
R7774:Olfr290 UTSW 7 84916531 missense probably damaging 0.97
R8126:Olfr290 UTSW 7 84915906 missense probably damaging 1.00
R8443:Olfr290 UTSW 7 84916579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCCCATGTATTACCTGTTGG -3'
(R):5'- TAGATGAGCATGACAGGGCC -3'

Sequencing Primer
(F):5'- ACTGGACATATTCTGCCCATCAG -3'
(R):5'- ATGACAGGGCCACCACAGG -3'
Posted On2017-01-03