Incidental Mutation 'R5884:Olfr1164'
ID454551
Institutional Source Beutler Lab
Gene Symbol Olfr1164
Ensembl Gene ENSMUSG00000075136
Gene Nameolfactory receptor 1164
SynonymsMOR174-11, GA_x6K02T2Q125-49585842-49584862
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5884 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88092855-88093966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88093796 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 47 (Y47H)
Ref Sequence ENSEMBL: ENSMUSP00000097422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099834]
Predicted Effect probably damaging
Transcript: ENSMUST00000099834
AA Change: Y47H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097422
Gene: ENSMUSG00000075136
AA Change: Y47H

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 3.8e-47 PFAM
Pfam:7tm_1 53 302 2.9e-15 PFAM
Meta Mutation Damage Score 0.1627 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Olfr1164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr1164 APN 2 88093016 missense possibly damaging 0.48
IGL02894:Olfr1164 APN 2 88093763 missense possibly damaging 0.79
IGL02977:Olfr1164 APN 2 88093571 missense probably benign
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0480:Olfr1164 UTSW 2 88093628 missense probably benign
R0644:Olfr1164 UTSW 2 88093289 missense probably benign 0.02
R1479:Olfr1164 UTSW 2 88093286 missense probably benign 0.05
R2047:Olfr1164 UTSW 2 88093893 missense probably benign 0.01
R2311:Olfr1164 UTSW 2 88093834 missense probably benign 0.00
R2973:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R3683:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R3685:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R4258:Olfr1164 UTSW 2 88093018 missense probably damaging 1.00
R4811:Olfr1164 UTSW 2 88093532 missense probably benign 0.08
R4970:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5112:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5258:Olfr1164 UTSW 2 88093418 missense probably benign 0.22
R6329:Olfr1164 UTSW 2 88093664 missense probably damaging 1.00
R6597:Olfr1164 UTSW 2 88093069 missense probably damaging 1.00
R7018:Olfr1164 UTSW 2 88093256 missense probably benign 0.00
R7055:Olfr1164 UTSW 2 88093701 missense probably damaging 1.00
R7314:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R7350:Olfr1164 UTSW 2 88093198 missense probably benign 0.01
R7527:Olfr1164 UTSW 2 88093610 missense probably damaging 1.00
R8003:Olfr1164 UTSW 2 88093245 nonsense probably null
Z1176:Olfr1164 UTSW 2 88093334 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCATGCATCCTTCAAAG -3'
(R):5'- GATACATGACTTCCCCGTGAC -3'

Sequencing Primer
(F):5'- TCAAAGGAGATTGATTTGTCTTCTAC -3'
(R):5'- GCCTGCATGCCATCATCG -3'
Posted On2017-02-10