Incidental Mutation 'R5925:Tpd52l1'
ID461792
Institutional Source Beutler Lab
Gene Symbol Tpd52l1
Ensembl Gene ENSMUSG00000000296
Gene Nametumor protein D52-like 1
SynonymsD53
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location31332376-31445958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31332947 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 170 (H170R)
Ref Sequence ENSEMBL: ENSMUSP00000000305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000304] [ENSMUST00000000305] [ENSMUST00000159194] [ENSMUST00000213528] [ENSMUST00000213639] [ENSMUST00000214644] [ENSMUST00000215515]
Predicted Effect probably benign
Transcript: ENSMUST00000000304
SMART Domains Protein: ENSMUSP00000000304
Gene: ENSMUSG00000000295

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
HDc 37 152 3.51e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000305
AA Change: H170R

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000305
Gene: ENSMUSG00000000296
AA Change: H170R

DomainStartEndE-ValueType
Pfam:TPD52 9 187 1.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159194
SMART Domains Protein: ENSMUSP00000124106
Gene: ENSMUSG00000000295

DomainStartEndE-ValueType
Pfam:HD_3 1 100 1.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159659
Predicted Effect probably benign
Transcript: ENSMUST00000213528
AA Change: H175R

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000213639
AA Change: H157R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214644
Predicted Effect probably benign
Transcript: ENSMUST00000215515
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain coiled-coil domains and may form hetero- or homomers. The encoded protein is involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Tpd52l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0134:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0225:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R4411:Tpd52l1 UTSW 10 31379319 missense possibly damaging 0.88
R4828:Tpd52l1 UTSW 10 31346701 missense probably damaging 1.00
R5073:Tpd52l1 UTSW 10 31357920 missense probably damaging 1.00
R6332:Tpd52l1 UTSW 10 31338207 missense probably damaging 1.00
R6848:Tpd52l1 UTSW 10 31332857 missense probably benign 0.03
R6906:Tpd52l1 UTSW 10 31332954 missense possibly damaging 0.47
R7900:Tpd52l1 UTSW 10 31338182 splice site probably null
R7935:Tpd52l1 UTSW 10 31338205 missense probably damaging 0.99
R8010:Tpd52l1 UTSW 10 31358013 missense possibly damaging 0.89
R8011:Tpd52l1 UTSW 10 31332917 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGGGATTTTGGTCTTCATATC -3'
(R):5'- TTCGAAATCTTATCCCAGAACCGAG -3'

Sequencing Primer
(F):5'- TCTTCATATCAGAGGATGAGCAGGC -3'
(R):5'- TCTTATCCCAGAACCGAGATTAATAC -3'
Posted On2017-02-28