Incidental Mutation 'R0508:Atp9a'
ID47711
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0508 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 168649526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably null
Transcript: ENSMUST00000029060
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109175
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109176
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109177
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178504
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Meta Mutation Damage Score 0.6012 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
R7490:Atp9a UTSW 2 168675352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGAGCTGAAGAGATGCTCACCTG -3'
(R):5'- TCTTTCTCCAGCAAACAGTCAGCC -3'

Sequencing Primer
(F):5'- GGGTCCCCCAGCCATTC -3'
(R):5'- TCACAGGGACTGAGTCTCAAG -3'
Posted On2013-06-12