Incidental Mutation 'R2882:Atp9a'
ID260341
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 040470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2882 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168706214 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 7 (Y7C)
Ref Sequence ENSEMBL: ENSMUSP00000121364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000123156] [ENSMUST00000151610] [ENSMUST00000156397] [ENSMUST00000156555] [ENSMUST00000178504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029060
AA Change: Y103C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: Y103C

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109175
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109176
AA Change: Y161C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: Y161C

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109177
AA Change: Y85C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: Y85C

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123156
AA Change: Y82C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114868
Gene: ENSMUSG00000027546
AA Change: Y82C

DomainStartEndE-ValueType
SCOP:d1eula_ 29 112 8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140188
Predicted Effect probably damaging
Transcript: ENSMUST00000151610
AA Change: Y7C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121364
Gene: ENSMUSG00000027546
AA Change: Y7C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156397
AA Change: Y136C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119732
Gene: ENSMUSG00000027546
AA Change: Y136C

DomainStartEndE-ValueType
SCOP:d1eula_ 83 189 6e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156555
AA Change: Y81C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119315
Gene: ENSMUSG00000027546
AA Change: Y81C

DomainStartEndE-ValueType
SCOP:d1eula_ 28 87 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178504
AA Change: Y103C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: Y103C

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C A 13: 59,742,943 Q354H probably benign Het
AF529169 C T 9: 89,602,802 V181I possibly damaging Het
Atxn3 C A 12: 101,937,411 L178F probably damaging Het
Cep112 T C 11: 108,519,212 S211P possibly damaging Het
Csl A G 10: 99,758,925 F93L probably damaging Het
Cyp4f40 A G 17: 32,668,073 I173V probably benign Het
Dcaf17 A G 2: 71,082,027 I319V possibly damaging Het
Dock5 T C 14: 67,839,620 Y258C probably damaging Het
Dpp10 T C 1: 123,445,203 E236G probably damaging Het
Dpyd A G 3: 119,065,030 D631G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Fat2 C A 11: 55,311,305 L314F probably damaging Het
Gsdmc T C 15: 63,779,795 I259V probably benign Het
Hydin C T 8: 110,566,923 L3501F possibly damaging Het
Kdm2a A G 19: 4,331,184 probably null Het
Klra1 A T 6: 130,377,863 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Mlh3 A T 12: 85,267,566 H615Q probably damaging Het
Mmp12 A G 9: 7,358,236 Y374C probably damaging Het
Mpp2 T C 11: 102,064,633 E97G probably benign Het
Oasl2 C T 5: 114,911,023 R175C probably damaging Het
Olfr348 A T 2: 36,787,190 I222F probably damaging Het
Pcdhac2 A T 18: 37,145,812 Q615L probably damaging Het
Ppm1h T A 10: 122,941,334 Y502N probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgm6 T C 2: 130,137,439 V163A probably benign Het
Tlr5 C T 1: 182,973,893 T240M probably damaging Het
Washc4 T C 10: 83,579,501 I785T possibly damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
R7490:Atp9a UTSW 2 168675352 missense probably benign 0.00
R7827:Atp9a UTSW 2 168705194 missense probably benign 0.03
R7833:Atp9a UTSW 2 168674857 missense probably benign 0.02
R7854:Atp9a UTSW 2 168648603 missense probably benign 0.02
R7916:Atp9a UTSW 2 168674857 missense probably benign 0.02
R7937:Atp9a UTSW 2 168648603 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATACCTGAACTGCAGCC -3'
(R):5'- AACTGTTTAGAGTCTGCGAGG -3'

Sequencing Primer
(F):5'- TGATACCTGAACTGCAGCCTGAAG -3'
(R):5'- GCACTCTCTGCTGGAGTG -3'
Posted On2015-01-23