Incidental Mutation 'R6021:Pfdn2'
ID478914
Institutional Source Beutler Lab
Gene Symbol Pfdn2
Ensembl Gene ENSMUSG00000006412
Gene Nameprefoldin 2
SynonymsESTM27, W48336
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6021 (G1)
Quality Score119.008
Status Validated
Chromosome1
Chromosomal Location171345670-171359254 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 171345770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006579] [ENSMUST00000064950] [ENSMUST00000097467] [ENSMUST00000111289] [ENSMUST00000111295] [ENSMUST00000111296] [ENSMUST00000111299] [ENSMUST00000111300] [ENSMUST00000129116] [ENSMUST00000135941] [ENSMUST00000148339] [ENSMUST00000156856]
Predicted Effect unknown
Transcript: ENSMUST00000006579
AA Change: A14E
SMART Domains Protein: ENSMUSP00000006579
Gene: ENSMUSG00000006412
AA Change: A14E

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Prefoldin_2 18 93 3e-24 PFAM
low complexity region 102 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064950
SMART Domains Protein: ENSMUSP00000068419
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097467
SMART Domains Protein: ENSMUSP00000095075
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111289
SMART Domains Protein: ENSMUSP00000106920
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 191 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111295
SMART Domains Protein: ENSMUSP00000106926
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 6.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111296
SMART Domains Protein: ENSMUSP00000106927
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 44 224 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111299
SMART Domains Protein: ENSMUSP00000106930
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111300
SMART Domains Protein: ENSMUSP00000106931
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129116
SMART Domains Protein: ENSMUSP00000120278
Gene: ENSMUSG00000013973

DomainStartEndE-ValueType
DED 24 103 1.34e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000135941
AA Change: A20E
SMART Domains Protein: ENSMUSP00000120106
Gene: ENSMUSG00000006412
AA Change: A20E

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Prefoldin_2 24 129 3.3e-32 PFAM
low complexity region 139 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146428
Predicted Effect probably benign
Transcript: ENSMUST00000148339
SMART Domains Protein: ENSMUSP00000119171
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 87 8.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156856
SMART Domains Protein: ENSMUSP00000116835
Gene: ENSMUSG00000013997

DomainStartEndE-ValueType
Pfam:CN_hydrolase 11 131 5.7e-25 PFAM
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Pfdn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4576001:Pfdn2 UTSW 1 171345742 missense unknown
R5094:Pfdn2 UTSW 1 171356499 intron probably benign
R6023:Pfdn2 UTSW 1 171356751 missense probably damaging 1.00
R6712:Pfdn2 UTSW 1 171357851 missense probably damaging 1.00
R6980:Pfdn2 UTSW 1 171357897 unclassified probably benign
R7332:Pfdn2 UTSW 1 171356594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCATCGCAGGTGGAATTC -3'
(R):5'- AGGTTCGTGATCACCTCCAG -3'

Sequencing Primer
(F):5'- ATTCACGGGGTCGGATCTCAAG -3'
(R):5'- GTTCGTGATCACCTCCAGAGACC -3'
Posted On2017-06-26