Incidental Mutation 'R0532:Olfr1333'
ID 49219
Institutional Source Beutler Lab
Gene Symbol Olfr1333
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor 1333
Synonyms MOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6
MMRRC Submission 038724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R0532 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118827659-118836279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118829700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 247 (T247P)
Ref Sequence ENSEMBL: ENSMUSP00000075398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000106361] [ENSMUST00000214477]
AlphaFold Q7TQV7
Predicted Effect probably damaging
Transcript: ENSMUST00000076019
AA Change: T247P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: T247P

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106361
AA Change: T248P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: T248P

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: T246P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: T246P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,638,618 E339V possibly damaging Het
9230009I02Rik A T 11: 51,091,578 noncoding transcript Het
9230112D13Rik A T 14: 34,512,097 I79K unknown Het
Adam25 C T 8: 40,755,950 T751I probably benign Het
Adgrv1 C A 13: 81,578,896 V446L probably damaging Het
Afap1 C A 5: 35,968,600 A313D possibly damaging Het
Akap6 A G 12: 52,887,983 T753A probably benign Het
Aldh16a1 G T 7: 45,142,838 T730N probably damaging Het
Amfr A T 8: 93,999,108 M215K probably damaging Het
Apob A G 12: 8,016,188 R4386G possibly damaging Het
Arhgap45 A T 10: 80,022,083 M217L possibly damaging Het
Baiap2l2 C T 15: 79,284,076 E49K possibly damaging Het
Baz1a C T 12: 54,934,820 E350K possibly damaging Het
Bbx A T 16: 50,266,284 V83D probably damaging Het
Btaf1 T C 19: 36,951,186 probably benign Het
Cacna2d1 G A 5: 16,362,273 E942K probably benign Het
Cad T C 5: 31,062,187 probably benign Het
Ccdc96 A G 5: 36,486,366 K572R probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cep164 G A 9: 45,809,826 R93* probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Crocc A G 4: 141,030,247 S912P possibly damaging Het
Cwf19l2 T C 9: 3,431,057 L463P probably benign Het
Cyp3a59 C T 5: 146,096,653 Q200* probably null Het
Cyp4b1 G T 4: 115,626,876 P303T probably damaging Het
Dcbld1 C A 10: 52,317,077 T306K probably benign Het
Dgat2 A G 7: 99,169,781 V56A possibly damaging Het
Dnajc16 A C 4: 141,789,009 L16R probably damaging Het
Dnmt1 A C 9: 20,918,556 probably benign Het
Dus3l A G 17: 56,769,308 I528V probably damaging Het
Egflam T C 15: 7,234,237 D744G probably benign Het
Epb41 A C 4: 131,978,795 probably benign Het
Eri2 C T 7: 119,785,983 V432I probably benign Het
Esyt2 A G 12: 116,357,198 probably benign Het
Extl3 A T 14: 65,077,673 M20K probably benign Het
Fam32a A G 8: 72,222,219 Y103C probably damaging Het
Fat4 T C 3: 38,981,721 V3174A probably benign Het
Fbxo40 T A 16: 36,969,622 E375D possibly damaging Het
Frrs1 A G 3: 116,883,164 T182A probably benign Het
Fry A G 5: 150,433,707 probably benign Het
Fry T C 5: 150,478,761 probably benign Het
Fsip2 A G 2: 82,977,785 I1483V probably benign Het
Glra3 T A 8: 56,125,076 D389E probably benign Het
Gpr3 A T 4: 133,210,485 I292N probably damaging Het
Grina T C 15: 76,248,845 M230T probably damaging Het
Igkv11-125 G A 6: 67,913,619 W16* probably null Het
Il18r1 T C 1: 40,474,901 V89A probably damaging Het
Ino80 T C 2: 119,381,983 E1286G possibly damaging Het
Iqch G A 9: 63,508,232 probably benign Het
Itpr2 G T 6: 146,112,400 Q2666K probably damaging Het
Kcnh3 A G 15: 99,232,963 D487G probably damaging Het
Kdm1a A G 4: 136,561,066 L402P probably damaging Het
Klhl10 T G 11: 100,447,111 probably benign Het
Krt39 T C 11: 99,514,791 T428A possibly damaging Het
Mapk3 G A 7: 126,763,386 probably benign Het
Med13l T A 5: 118,759,123 S2089T possibly damaging Het
Mex3c G A 18: 73,590,053 D406N possibly damaging Het
Mki67 G A 7: 135,698,164 R1714* probably null Het
Mmp9 C A 2: 164,949,820 S211* probably null Het
Nat8f2 G T 6: 85,867,802 Q193K probably benign Het
Olfr204 T C 16: 59,314,601 K269E probably benign Het
Omt2a C A 9: 78,312,905 A71S possibly damaging Het
Pdgfra G A 5: 75,170,773 V315I probably benign Het
Pdgfrb A G 18: 61,083,265 D1065G probably damaging Het
Pfas A T 11: 69,002,629 probably benign Het
Pramel5 T C 4: 144,272,740 E259G probably benign Het
Prpf6 A G 2: 181,622,211 Y222C possibly damaging Het
Rbck1 C A 2: 152,324,330 Q229H probably damaging Het
Rdm1 T A 11: 101,635,835 C278S probably benign Het
Sall1 T C 8: 89,033,191 D95G probably benign Het
Scn1a T A 2: 66,317,823 D1126V probably damaging Het
Scn4a C T 11: 106,330,400 G811D probably benign Het
Sh2b1 A G 7: 126,472,272 I247T probably benign Het
Shprh C A 10: 11,162,812 T437K possibly damaging Het
Slc13a4 A T 6: 35,287,404 probably null Het
Slc16a1 C A 3: 104,653,418 Y346* probably null Het
Slc25a38 G T 9: 120,120,706 A163S probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 C A 5: 120,519,671 D66E probably damaging Het
Snapin A G 3: 90,489,586 L106P probably damaging Het
Tas2r122 G A 6: 132,711,828 S34F possibly damaging Het
Tiam2 A G 17: 3,421,646 K521R probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Ttc3 T C 16: 94,387,330 probably benign Het
Uba1y T C Y: 820,911 F31L probably benign Het
Ucp3 A G 7: 100,481,979 probably benign Het
Vcan T C 13: 89,703,772 E1023G probably damaging Het
Vmn2r45 A G 7: 8,471,821 I736T probably damaging Het
Vps36 T C 8: 22,218,245 F342L probably benign Het
Zc3hc1 A G 6: 30,374,930 probably benign Het
Zmym4 G A 4: 126,898,401 Q596* probably null Het
Other mutations in Olfr1333
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1333 APN 4 118829792 missense probably benign 0.30
IGL03023:Olfr1333 APN 4 118830252 missense probably damaging 0.99
IGL03387:Olfr1333 APN 4 118830041 missense probably damaging 1.00
R0326:Olfr1333 UTSW 4 118829825 missense possibly damaging 0.90
R1775:Olfr1333 UTSW 4 118829868 missense probably benign 0.00
R1906:Olfr1333 UTSW 4 118830270 missense probably damaging 1.00
R1946:Olfr1333 UTSW 4 118830026 missense probably benign 0.00
R2260:Olfr1333 UTSW 4 118830162 missense probably damaging 1.00
R5084:Olfr1333 UTSW 4 118829570 missense probably damaging 1.00
R5337:Olfr1333 UTSW 4 118829666 missense probably benign 0.44
R5444:Olfr1333 UTSW 4 118830111 missense probably benign
R5817:Olfr1333 UTSW 4 118830099 missense probably damaging 0.96
R5973:Olfr1333 UTSW 4 118830216 missense probably benign 0.22
R5987:Olfr1333 UTSW 4 118830281 missense probably damaging 0.96
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R7255:Olfr1333 UTSW 4 118829952 missense probably benign 0.17
R7483:Olfr1333 UTSW 4 118830320 missense probably damaging 0.98
R8214:Olfr1333 UTSW 4 118830091 missense probably benign
R8479:Olfr1333 UTSW 4 118830015 missense probably damaging 1.00
R8847:Olfr1333 UTSW 4 118829624 missense probably damaging 0.97
Z1176:Olfr1333 UTSW 4 118830050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATCACCATCCTGGTCCACTG -3'
(R):5'- AGCTTGGCTTGCATGGATACCCAC -3'

Sequencing Primer
(F):5'- TGGCACACCTGTCATAACC -3'
(R):5'- TGCATGGATACCCACATCATTG -3'
Posted On 2013-06-12