Incidental Mutation 'R0532:Pramel5'
ID 49226
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Name preferentially expressed antigen in melanoma like 5
Synonyms OTTMUSG00000010540
MMRRC Submission 038724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R0532 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 144270633-144280488 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144272740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 259 (E259G)
Ref Sequence ENSEMBL: ENSMUSP00000101378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect probably benign
Transcript: ENSMUST00000035757
AA Change: E259G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: E259G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105752
AA Change: E259G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: E259G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144127
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,638,618 (GRCm38) E339V possibly damaging Het
9230009I02Rik A T 11: 51,091,578 (GRCm38) noncoding transcript Het
9230112D13Rik A T 14: 34,512,097 (GRCm38) I79K unknown Het
Adam25 C T 8: 40,755,950 (GRCm38) T751I probably benign Het
Adgrv1 C A 13: 81,578,896 (GRCm38) V446L probably damaging Het
Afap1 C A 5: 35,968,600 (GRCm38) A313D possibly damaging Het
Akap6 A G 12: 52,887,983 (GRCm38) T753A probably benign Het
Aldh16a1 G T 7: 45,142,838 (GRCm38) T730N probably damaging Het
Amfr A T 8: 93,999,108 (GRCm38) M215K probably damaging Het
Apob A G 12: 8,016,188 (GRCm38) R4386G possibly damaging Het
Arhgap45 A T 10: 80,022,083 (GRCm38) M217L possibly damaging Het
Baiap2l2 C T 15: 79,284,076 (GRCm38) E49K possibly damaging Het
Baz1a C T 12: 54,934,820 (GRCm38) E350K possibly damaging Het
Bbx A T 16: 50,266,284 (GRCm38) V83D probably damaging Het
Btaf1 T C 19: 36,951,186 (GRCm38) probably benign Het
Cacna2d1 G A 5: 16,362,273 (GRCm38) E942K probably benign Het
Cad T C 5: 31,062,187 (GRCm38) probably benign Het
Ccdc96 A G 5: 36,486,366 (GRCm38) K572R probably benign Het
Cdc5l G A 17: 45,415,684 (GRCm38) R321W probably damaging Het
Cep164 G A 9: 45,809,826 (GRCm38) R93* probably null Het
Cir1 A G 2: 73,310,455 (GRCm38) probably null Het
Crocc A G 4: 141,030,247 (GRCm38) S912P possibly damaging Het
Cwf19l2 T C 9: 3,431,057 (GRCm38) L463P probably benign Het
Cyp3a59 C T 5: 146,096,653 (GRCm38) Q200* probably null Het
Cyp4b1 G T 4: 115,626,876 (GRCm38) P303T probably damaging Het
Dcbld1 C A 10: 52,317,077 (GRCm38) T306K probably benign Het
Dgat2 A G 7: 99,169,781 (GRCm38) V56A possibly damaging Het
Dnajc16 A C 4: 141,789,009 (GRCm38) L16R probably damaging Het
Dnmt1 A C 9: 20,918,556 (GRCm38) probably benign Het
Dus3l A G 17: 56,769,308 (GRCm38) I528V probably damaging Het
Egflam T C 15: 7,234,237 (GRCm38) D744G probably benign Het
Epb41 A C 4: 131,978,795 (GRCm38) probably benign Het
Eri2 C T 7: 119,785,983 (GRCm38) V432I probably benign Het
Esyt2 A G 12: 116,357,198 (GRCm38) probably benign Het
Extl3 A T 14: 65,077,673 (GRCm38) M20K probably benign Het
Fam32a A G 8: 72,222,219 (GRCm38) Y103C probably damaging Het
Fat4 T C 3: 38,981,721 (GRCm38) V3174A probably benign Het
Fbxo40 T A 16: 36,969,622 (GRCm38) E375D possibly damaging Het
Frrs1 A G 3: 116,883,164 (GRCm38) T182A probably benign Het
Fry A G 5: 150,433,707 (GRCm38) probably benign Het
Fry T C 5: 150,478,761 (GRCm38) probably benign Het
Fsip2 A G 2: 82,977,785 (GRCm38) I1483V probably benign Het
Glra3 T A 8: 56,125,076 (GRCm38) D389E probably benign Het
Gpr3 A T 4: 133,210,485 (GRCm38) I292N probably damaging Het
Grina T C 15: 76,248,845 (GRCm38) M230T probably damaging Het
Igkv11-125 G A 6: 67,913,619 (GRCm38) W16* probably null Het
Il18r1 T C 1: 40,474,901 (GRCm38) V89A probably damaging Het
Ino80 T C 2: 119,381,983 (GRCm38) E1286G possibly damaging Het
Iqch G A 9: 63,508,232 (GRCm38) probably benign Het
Itpr2 G T 6: 146,112,400 (GRCm38) Q2666K probably damaging Het
Kcnh3 A G 15: 99,232,963 (GRCm38) D487G probably damaging Het
Kdm1a A G 4: 136,561,066 (GRCm38) L402P probably damaging Het
Klhl10 T G 11: 100,447,111 (GRCm38) probably benign Het
Krt39 T C 11: 99,514,791 (GRCm38) T428A possibly damaging Het
Mapk3 G A 7: 126,763,386 (GRCm38) probably benign Het
Med13l T A 5: 118,759,123 (GRCm38) S2089T possibly damaging Het
Mex3c G A 18: 73,590,053 (GRCm38) D406N possibly damaging Het
Mki67 G A 7: 135,698,164 (GRCm38) R1714* probably null Het
Mmp9 C A 2: 164,949,820 (GRCm38) S211* probably null Het
Nat8f2 G T 6: 85,867,802 (GRCm38) Q193K probably benign Het
Olfr1333 T G 4: 118,829,700 (GRCm38) T247P probably damaging Het
Olfr204 T C 16: 59,314,601 (GRCm38) K269E probably benign Het
Omt2a C A 9: 78,312,905 (GRCm38) A71S possibly damaging Het
Pdgfra G A 5: 75,170,773 (GRCm38) V315I probably benign Het
Pdgfrb A G 18: 61,083,265 (GRCm38) D1065G probably damaging Het
Pfas A T 11: 69,002,629 (GRCm38) probably benign Het
Prpf6 A G 2: 181,622,211 (GRCm38) Y222C possibly damaging Het
Rbck1 C A 2: 152,324,330 (GRCm38) Q229H probably damaging Het
Rdm1 T A 11: 101,635,835 (GRCm38) C278S probably benign Het
Sall1 T C 8: 89,033,191 (GRCm38) D95G probably benign Het
Scn1a T A 2: 66,317,823 (GRCm38) D1126V probably damaging Het
Scn4a C T 11: 106,330,400 (GRCm38) G811D probably benign Het
Sh2b1 A G 7: 126,472,272 (GRCm38) I247T probably benign Het
Shprh C A 10: 11,162,812 (GRCm38) T437K possibly damaging Het
Slc13a4 A T 6: 35,287,404 (GRCm38) probably null Het
Slc16a1 C A 3: 104,653,418 (GRCm38) Y346* probably null Het
Slc25a38 G T 9: 120,120,706 (GRCm38) A163S probably damaging Het
Slc6a12 G A 6: 121,356,918 (GRCm38) V238I probably damaging Het
Slc8b1 C A 5: 120,519,671 (GRCm38) D66E probably damaging Het
Snapin A G 3: 90,489,586 (GRCm38) L106P probably damaging Het
Tas2r122 G A 6: 132,711,828 (GRCm38) S34F possibly damaging Het
Tiam2 A G 17: 3,421,646 (GRCm38) K521R probably damaging Het
Tmem81 C G 1: 132,507,829 (GRCm38) I124M probably damaging Het
Ttc3 T C 16: 94,387,330 (GRCm38) probably benign Het
Uba1y T C Y: 820,911 (GRCm38) F31L probably benign Het
Ucp3 A G 7: 100,481,979 (GRCm38) probably benign Het
Vcan T C 13: 89,703,772 (GRCm38) E1023G probably damaging Het
Vmn2r45 A G 7: 8,471,821 (GRCm38) I736T probably damaging Het
Vps36 T C 8: 22,218,245 (GRCm38) F342L probably benign Het
Zc3hc1 A G 6: 30,374,930 (GRCm38) probably benign Het
Zmym4 G A 4: 126,898,401 (GRCm38) Q596* probably null Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144,271,621 (GRCm38) missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144,273,979 (GRCm38) missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144,271,272 (GRCm38) missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144,271,162 (GRCm38) utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144,273,859 (GRCm38) missense probably benign 0.01
IGL02150:Pramel5 APN 4 144,273,201 (GRCm38) missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144,271,551 (GRCm38) missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144,273,112 (GRCm38) missense probably benign 0.25
IGL02868:Pramel5 APN 4 144,271,352 (GRCm38) missense probably benign 0.03
IGL02981:Pramel5 APN 4 144,272,860 (GRCm38) missense probably benign 0.01
R0646:Pramel5 UTSW 4 144,271,620 (GRCm38) missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144,271,488 (GRCm38) missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144,273,863 (GRCm38) nonsense probably null
R2027:Pramel5 UTSW 4 144,271,704 (GRCm38) missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144,272,936 (GRCm38) nonsense probably null
R2439:Pramel5 UTSW 4 144,273,740 (GRCm38) missense probably benign 0.01
R3922:Pramel5 UTSW 4 144,273,052 (GRCm38) missense probably damaging 1.00
R4470:Pramel5 UTSW 4 144,271,345 (GRCm38) missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 144,272,755 (GRCm38) missense probably benign 0.04
R4969:Pramel5 UTSW 4 144,271,617 (GRCm38) missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144,271,741 (GRCm38) missense probably benign 0.01
R5198:Pramel5 UTSW 4 144,273,494 (GRCm38) intron probably benign
R5930:Pramel5 UTSW 4 144,272,983 (GRCm38) missense probably benign 0.43
R5988:Pramel5 UTSW 4 144,273,146 (GRCm38) missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144,273,105 (GRCm38) missense probably benign 0.32
R6988:Pramel5 UTSW 4 144,274,007 (GRCm38) start gained probably benign
R7116:Pramel5 UTSW 4 144,273,881 (GRCm38) missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144,271,440 (GRCm38) missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 144,272,825 (GRCm38) missense probably damaging 1.00
R8993:Pramel5 UTSW 4 144,272,959 (GRCm38) missense possibly damaging 0.81
R9049:Pramel5 UTSW 4 144,273,916 (GRCm38) missense probably benign 0.02
R9402:Pramel5 UTSW 4 144,271,456 (GRCm38) missense probably benign 0.15
R9632:Pramel5 UTSW 4 144,272,975 (GRCm38) missense probably benign 0.15
R9710:Pramel5 UTSW 4 144,272,975 (GRCm38) missense probably benign 0.15
X0028:Pramel5 UTSW 4 144,272,836 (GRCm38) missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144,273,860 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTGCTCAAAATACCTCTGACCC -3'
(R):5'- CTGTCCCGAACTGAGGTTCTTGAAG -3'

Sequencing Primer
(F):5'- TCATGGACACCTACGTGATG -3'
(R):5'- CCGAACTGAGGTTCTTGAAGTTTTC -3'
Posted On 2013-06-12