Incidental Mutation 'R0539:Mprip'
ID49721
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 038731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R0539 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 59741117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect probably benign
Transcript: ENSMUST00000066330
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153531
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Crybg1 T C 10: 43,998,898 D738G probably benign Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Grm7 T G 6: 111,359,094 probably benign Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Map1b T C 13: 99,434,018 K732E unknown Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mrc1 T C 2: 14,270,126 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Robo2 A T 16: 73,985,574 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
R7764:Mprip UTSW 11 59764416 missense probably damaging 0.99
R7765:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R7828:Mprip UTSW 11 59737089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAGTAGACTGAATCTGTGCCC -3'
(R):5'- ACATGTACGGCACTGTGTTCCC -3'

Sequencing Primer
(F):5'- GAATCTGTGCCCTAAGTCCTATCAG -3'
(R):5'- TGTGTTCCCCAGACCCAAG -3'
Posted On2013-06-12