Incidental Mutation 'R0539:Crybg1'
ID49717
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission 038731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0539 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43998898 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 738 (D738G)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably benign
Transcript: ENSMUST00000020017
AA Change: D364G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: D738G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: D738G

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Grm7 T G 6: 111,359,094 probably benign Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Map1b T C 13: 99,434,018 K732E unknown Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mprip T C 11: 59,741,117 probably benign Het
Mrc1 T C 2: 14,270,126 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Robo2 A T 16: 73,985,574 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
R8359:Crybg1 UTSW 10 43992542 missense probably benign 0.03
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGGAGCGTCCACAGAAATG -3'
(R):5'- TGTGTCAACCAGCCACCAGAATG -3'

Sequencing Primer
(F):5'- TCAGAAAATGCATCCTGTGGC -3'
(R):5'- ATGGCCTGGTGGTCAAAG -3'
Posted On2013-06-12