Incidental Mutation 'R4578:Nfib'
ID500001
Institutional Source Beutler Lab
Gene Symbol Nfib
Ensembl Gene ENSMUSG00000008575
Gene Namenuclear factor I/B
Synonyms
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location82290173-82705750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82296811 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 518 (S518R)
Ref Sequence ENSEMBL: ENSMUSP00000102868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050872] [ENSMUST00000064770] [ENSMUST00000107245] [ENSMUST00000107246] [ENSMUST00000107247] [ENSMUST00000107248]
Predicted Effect probably damaging
Transcript: ENSMUST00000050872
AA Change: S528R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052863
Gene: ENSMUSG00000008575
AA Change: S528R

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.2e-29 PFAM
DWA 68 176 1.65e-19 SMART
Pfam:CTF_NFI 209 506 5.7e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064770
AA Change: S416T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067629
Gene: ENSMUSG00000008575
AA Change: S416T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 3.7e-30 PFAM
DWA 68 176 1.65e-19 SMART
Pfam:CTF_NFI 209 419 2.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107245
AA Change: S489T

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102865
Gene: ENSMUSG00000008575
AA Change: S489T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 2.9e-30 PFAM
DWA 67 175 1.65e-19 SMART
Pfam:CTF_NFI 208 493 1.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107246
AA Change: S444R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102866
Gene: ENSMUSG00000008575
AA Change: S444R

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 5.9e-30 PFAM
DWA 67 175 1.65e-19 SMART
Pfam:CTF_NFI 208 462 3.7e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107247
AA Change: S518R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102868
Gene: ENSMUSG00000008575
AA Change: S518R

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.5e-31 PFAM
DWA 67 175 1.65e-19 SMART
Pfam:CTF_NFI 208 492 2.5e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107248
AA Change: S527R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102869
Gene: ENSMUSG00000008575
AA Change: S527R

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 6.9e-30 PFAM
DWA 67 175 1.65e-19 SMART
Pfam:CTF_NFI 208 501 1.5e-125 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes severe lung defects and neonatal death from respiratory failure. Homozygotes for a null allele show callosal agenesis and abnormalities in forebrain, basilar pons, hippocampus, and submandibular gland development, as well as lung maturation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Cngb3 T A 4: 19,425,613 W474R probably damaging Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Nfib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01839:Nfib APN 4 82310370 missense probably benign
R0220:Nfib UTSW 4 82296776 missense probably damaging 0.99
R0309:Nfib UTSW 4 82296737 missense probably damaging 1.00
R0352:Nfib UTSW 4 82504717 intron probably benign
R0466:Nfib UTSW 4 82498538 missense probably damaging 1.00
R1643:Nfib UTSW 4 82498679 missense probably damaging 1.00
R1737:Nfib UTSW 4 82498589 missense probably damaging 0.99
R1860:Nfib UTSW 4 82323680 missense probably damaging 1.00
R2069:Nfib UTSW 4 82498615 missense probably damaging 1.00
R2103:Nfib UTSW 4 82330408 missense possibly damaging 0.57
R3429:Nfib UTSW 4 82498295 missense possibly damaging 0.75
R3430:Nfib UTSW 4 82498295 missense possibly damaging 0.75
R3755:Nfib UTSW 4 82323699 missense probably damaging 1.00
R4373:Nfib UTSW 4 82323658 missense probably damaging 0.97
R4433:Nfib UTSW 4 82498435 missense probably damaging 1.00
R4575:Nfib UTSW 4 82296811 missense probably damaging 0.99
R4719:Nfib UTSW 4 82504730 critical splice donor site probably null
R4752:Nfib UTSW 4 82296779 missense probably damaging 0.97
R4953:Nfib UTSW 4 82353571 missense probably benign 0.20
R5533:Nfib UTSW 4 82359767 missense probably damaging 0.99
R6583:Nfib UTSW 4 82498471 missense probably damaging 1.00
R7055:Nfib UTSW 4 82330425 missense probably benign 0.03
R7162:Nfib UTSW 4 82350440 missense probably damaging 0.97
R7204:Nfib UTSW 4 82296815 splice site probably null
R7462:Nfib UTSW 4 82353589 missense probably benign 0.05
R7465:Nfib UTSW 4 82353521 critical splice donor site probably null
R7764:Nfib UTSW 4 82320494 missense possibly damaging 0.72
R7894:Nfib UTSW 4 82327793 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGCTGGTCTACCGTCTTC -3'
(R):5'- AGGTCTTTTCATGGAAGCAAGAG -3'

Sequencing Primer
(F):5'- GTTGGGTGTTTTTCCCCTAATTTTC -3'
(R):5'- GCAAGAGATCATATAGATTACACCTG -3'
Posted On2017-11-30