Mutagenetix > Incidental Mutations

Incidental Mutation 'R4578:Taf6l'

343451

Institutional Source

Beutler Lab

Gene Symbol

Taf6l

Ensembl Gene

ENSMUSG00000003680

Gene Name

TATA-box binding protein associated factor 6 like

Synonyms

PAF65A, 2810417N14Rik, C530024J06Rik

MMRRC Submission

041800-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R4578 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8772522-8786417 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 8783971 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 10 (R10L)

Ref Sequence

ENSEMBL: ENSMUSP00000140136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003777
AA Change: R10L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: R10L

Domain	Start	End	E-Value	Type
TAF	16	79	9.03e-28	SMART
Pfam:DUF1546	248	339	4.5e-29	PFAM
low complexity region	565	576	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176331

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176496
AA Change: R11L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680
AA Change: R11L

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	224	315	4.3e-29	PFAM
low complexity region	541	552	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176610
AA Change: R11L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: R11L

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:TAF6_C	249	338	6.6e-22	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176719

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176747

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176991

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177056
AA Change: R4L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: R4L

Domain	Start	End	E-Value	Type
TAF	10	73	9.03e-28	SMART
Pfam:DUF1546	242	333	4.5e-29	PFAM
low complexity region	559	570	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177216
AA Change: R11L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: R11L

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	249	340	6.4e-29	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000189739
AA Change: R10L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680
AA Change: R10L

Domain	Start	End	E-Value	Type
TAF	16	79	3.8e-31	SMART
Pfam:DUF1546	223	314	6.3e-26	PFAM
low complexity region	540	551	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,736,671	Y440*	probably null	Het
Aldh3b3	A	T	19: 3,964,832	T110S	probably benign	Het
Atp2b2	T	C	6: 113,760,711	T901A	probably damaging	Het
Auts2	C	T	5: 132,258,934	G70E	probably benign	Het
Bfar	A	T	16: 13,687,443	I106F	probably benign	Het
Btbd10	T	G	7: 113,322,752	I301L	possibly damaging	Het
Card14	G	A	11: 119,326,741	R400H	probably benign	Het
Ccdc80	A	G	16: 45,095,486	R202G	probably damaging	Het
Cmtm7	A	C	9: 114,763,283	I82S	probably benign	Het
Cngb3	T	A	4: 19,425,613	W474R	probably damaging	Het
Coq9	T	C	8: 94,853,606	V285A	probably benign	Het
Cp	A	G	3: 19,973,888	E486G	probably damaging	Het
Crybg3	C	T	16: 59,530,201	C892Y	probably damaging	Het
Cttn	A	T	7: 144,454,716	F176L	probably damaging	Het
Cytip	T	A	2: 58,160,012	N15I	possibly damaging	Het
Dgkb	A	G	12: 38,427,493	E634G	possibly damaging	Het
Duox1	A	G	2: 122,333,777	E906G	probably benign	Het
Efcab6	A	T	15: 83,933,168	S735T	probably benign	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
Ercc5	T	A	1: 44,148,148	V29E	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Ftcd	A	C	10: 76,589,258	E524D	probably benign	Het
Gfod2	T	C	8: 105,728,246	M1V	probably null	Het
Gm12790	T	C	4: 101,968,127	D30G	probably benign	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gsta4	A	T	9: 78,206,020	R127S	probably benign	Het
Hcn2	G	A	10: 79,724,448		probably null	Het
Hectd1	A	G	12: 51,751,932	V2135A	probably damaging	Het
Hoxc6	A	G	15: 103,009,661	D19G	probably benign	Het
Hydin	A	T	8: 110,267,339	T2S	unknown	Het
Ifna14	A	T	4: 88,571,510	S97T	possibly damaging	Het
Igkv17-127	T	C	6: 67,861,199	L14P	unknown	Het
Il17rb	A	G	14: 30,002,399	V166A	probably damaging	Het
Iqca	T	A	1: 90,073,750	I520F	probably damaging	Het
Kcnv2	G	T	19: 27,323,594	V282L	probably benign	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Lrfn5	A	G	12: 61,843,977	D684G	probably benign	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mis18bp1	T	C	12: 65,153,881	Y124C	probably damaging	Het
Myh2	T	A	11: 67,173,258	V48D	possibly damaging	Het
Nat10	A	G	2: 103,754,072	M120T	probably damaging	Het
Nf1	T	C	11: 79,445,759	S1065P	probably damaging	Het
Nfib	A	T	4: 82,296,811	S518R	probably damaging	Het
Pced1a	A	C	2: 130,422,676	L78R	probably damaging	Het
Peli3	T	C	19: 4,934,458	D192G	probably benign	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Pomgnt2	G	A	9: 121,983,065	R217C	probably damaging	Het
Ptprd	C	T	4: 76,243,786	V78I	possibly damaging	Het
Rngtt	A	G	4: 33,339,050	E285G	probably benign	Het
Sclt1	G	A	3: 41,671,465	Q356*	probably null	Het
Scn2b	T	C	9: 45,126,162	F169S	possibly damaging	Het
Sfta2	C	T	17: 35,649,883		probably benign	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Sspo	A	C	6: 48,463,373	D1541A	possibly damaging	Het
Strc	G	A	2: 121,378,003	L296F	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Tbx3	G	T	5: 119,682,776	R617L	probably damaging	Het
Tnrc6a	A	G	7: 123,184,221	R1471G	possibly damaging	Het
Togaram1	T	C	12: 65,020,326	L1714P	probably damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Vcp	A	T	4: 42,984,565	M442K	probably benign	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het
Vmn2r52	A	T	7: 10,170,690	H407Q	probably damaging	Het
Vps13a	A	T	19: 16,682,110	D1684E	probably damaging	Het
Wdr49	T	C	3: 75,335,243	M380V	probably benign	Het

Other mutations in Taf6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Taf6l	APN	19	8783388	missense	probably benign	0.04
IGL00781:Taf6l	APN	19	8773661	missense	probably damaging	1.00
IGL01886:Taf6l	APN	19	8778086	critical splice donor site	probably null
IGL02638:Taf6l	APN	19	8775266	missense	probably benign	0.03
IGL02676:Taf6l	APN	19	8775049	missense	probably damaging	1.00
R0096:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R0110:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0469:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0510:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0676:Taf6l	UTSW	19	8773369	missense	probably benign	0.00
R0711:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R1804:Taf6l	UTSW	19	8773634	missense	probably damaging	0.99
R1971:Taf6l	UTSW	19	8775502	splice site	probably null
R2869:Taf6l	UTSW	19	8778628	unclassified	probably benign
R2870:Taf6l	UTSW	19	8778628	unclassified	probably benign
R3105:Taf6l	UTSW	19	8778855	missense	probably damaging	1.00
R4581:Taf6l	UTSW	19	8778208	missense	probably damaging	0.99
R4841:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R4842:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R5215:Taf6l	UTSW	19	8778053	intron	probably benign
R5269:Taf6l	UTSW	19	8774962	missense	probably damaging	1.00
R5571:Taf6l	UTSW	19	8783930	missense	probably damaging	1.00
R5687:Taf6l	UTSW	19	8773312	missense	probably benign	0.01
R5799:Taf6l	UTSW	19	8782631	missense	possibly damaging	0.93
R5814:Taf6l	UTSW	19	8774846	missense	probably benign	0.13
R6008:Taf6l	UTSW	19	8778166	missense	possibly damaging	0.65
R6091:Taf6l	UTSW	19	8778556	missense	probably benign	0.04
R6228:Taf6l	UTSW	19	8778666	missense	probably benign	0.01
R6569:Taf6l	UTSW	19	8772710	missense	probably damaging	1.00
R6768:Taf6l	UTSW	19	8774549	missense	probably damaging	1.00
R7586:Taf6l	UTSW	19	8783846	missense	probably damaging	0.99
R8282:Taf6l	UTSW	19	8773350	missense	possibly damaging	0.95
Z1176:Taf6l	UTSW	19	8782544	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- TGTTGCCAAGCATGTCAGTGG -3'
(R):5'- AGTGTCATCTTGGACTAGGGTC -3'

Sequencing Primer
(F):5'- CCAAGCATGTCAGTGGGGAAG -3'
(R):5'- TCGTGCTGTGCTGAGCCTC -3'

Posted On

2015-09-24