Incidental Mutation 'R4578:Cngb3'
ID343385
Institutional Source Beutler Lab
Gene Symbol Cngb3
Ensembl Gene ENSMUSG00000056494
Gene Namecyclic nucleotide gated channel beta 3
SynonymsCCNC2, CNG6, Cngbeta2
MMRRC Submission 041800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4578 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location19280850-19510623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19425613 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 474 (W474R)
Ref Sequence ENSEMBL: ENSMUSP00000100064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102999]
Predicted Effect probably damaging
Transcript: ENSMUST00000102999
AA Change: W474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: W474R

DomainStartEndE-ValueType
Pfam:Ion_trans 210 445 5.7e-21 PFAM
cNMP 516 635 5.99e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,671 Y440* probably null Het
Aldh3b3 A T 19: 3,964,832 T110S probably benign Het
Atp2b2 T C 6: 113,760,711 T901A probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Bfar A T 16: 13,687,443 I106F probably benign Het
Btbd10 T G 7: 113,322,752 I301L possibly damaging Het
Card14 G A 11: 119,326,741 R400H probably benign Het
Ccdc80 A G 16: 45,095,486 R202G probably damaging Het
Cmtm7 A C 9: 114,763,283 I82S probably benign Het
Coq9 T C 8: 94,853,606 V285A probably benign Het
Cp A G 3: 19,973,888 E486G probably damaging Het
Crybg3 C T 16: 59,530,201 C892Y probably damaging Het
Cttn A T 7: 144,454,716 F176L probably damaging Het
Cytip T A 2: 58,160,012 N15I possibly damaging Het
Dgkb A G 12: 38,427,493 E634G possibly damaging Het
Duox1 A G 2: 122,333,777 E906G probably benign Het
Efcab6 A T 15: 83,933,168 S735T probably benign Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Ercc5 T A 1: 44,148,148 V29E probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Ftcd A C 10: 76,589,258 E524D probably benign Het
Gfod2 T C 8: 105,728,246 M1V probably null Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsta4 A T 9: 78,206,020 R127S probably benign Het
Hcn2 G A 10: 79,724,448 probably null Het
Hectd1 A G 12: 51,751,932 V2135A probably damaging Het
Hoxc6 A G 15: 103,009,661 D19G probably benign Het
Hydin A T 8: 110,267,339 T2S unknown Het
Ifna14 A T 4: 88,571,510 S97T possibly damaging Het
Igkv17-127 T C 6: 67,861,199 L14P unknown Het
Il17rb A G 14: 30,002,399 V166A probably damaging Het
Iqca T A 1: 90,073,750 I520F probably damaging Het
Kcnv2 G T 19: 27,323,594 V282L probably benign Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Lrfn5 A G 12: 61,843,977 D684G probably benign Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mis18bp1 T C 12: 65,153,881 Y124C probably damaging Het
Myh2 T A 11: 67,173,258 V48D possibly damaging Het
Nat10 A G 2: 103,754,072 M120T probably damaging Het
Nf1 T C 11: 79,445,759 S1065P probably damaging Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Pced1a A C 2: 130,422,676 L78R probably damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Pomgnt2 G A 9: 121,983,065 R217C probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rngtt A G 4: 33,339,050 E285G probably benign Het
Sclt1 G A 3: 41,671,465 Q356* probably null Het
Scn2b T C 9: 45,126,162 F169S possibly damaging Het
Sfta2 C T 17: 35,649,883 probably benign Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Sspo A C 6: 48,463,373 D1541A possibly damaging Het
Strc G A 2: 121,378,003 L296F possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Taf6l C A 19: 8,783,971 R10L possibly damaging Het
Tbx3 G T 5: 119,682,776 R617L probably damaging Het
Tnrc6a A G 7: 123,184,221 R1471G possibly damaging Het
Togaram1 T C 12: 65,020,326 L1714P probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Vcp A T 4: 42,984,565 M442K probably benign Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Vmn2r52 A T 7: 10,170,690 H407Q probably damaging Het
Vps13a A T 19: 16,682,110 D1684E probably damaging Het
Wdr49 T C 3: 75,335,243 M380V probably benign Het
Other mutations in Cngb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Cngb3 APN 4 19280956 missense probably damaging 0.98
IGL01301:Cngb3 APN 4 19425625 missense probably damaging 1.00
IGL01735:Cngb3 APN 4 19415648 missense probably damaging 1.00
IGL01756:Cngb3 APN 4 19367850 missense probably damaging 1.00
IGL01812:Cngb3 APN 4 19461728 missense possibly damaging 0.86
IGL02123:Cngb3 APN 4 19367801 missense probably damaging 0.99
IGL02636:Cngb3 APN 4 19396690 missense probably damaging 1.00
IGL02648:Cngb3 APN 4 19428489 missense probably benign 0.00
IGL02935:Cngb3 APN 4 19425491 missense possibly damaging 0.95
IGL03025:Cngb3 APN 4 19283498 splice site probably benign
IGL03068:Cngb3 APN 4 19375246 missense possibly damaging 0.92
braced UTSW 4 19395922 splice site probably benign
ANU18:Cngb3 UTSW 4 19425625 missense probably damaging 1.00
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0195:Cngb3 UTSW 4 19280975 missense probably benign 0.00
R0361:Cngb3 UTSW 4 19366467 missense probably benign 0.00
R0480:Cngb3 UTSW 4 19309517 splice site probably benign
R1103:Cngb3 UTSW 4 19309658 critical splice donor site probably null
R1450:Cngb3 UTSW 4 19395922 splice site probably benign
R1618:Cngb3 UTSW 4 19364260 missense probably benign
R1891:Cngb3 UTSW 4 19366446 missense probably benign 0.00
R2196:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R2850:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R3909:Cngb3 UTSW 4 19461679 missense probably damaging 1.00
R3941:Cngb3 UTSW 4 19396786 missense probably benign 0.00
R4348:Cngb3 UTSW 4 19396688 missense probably damaging 1.00
R4490:Cngb3 UTSW 4 19415684 missense probably benign 0.41
R4493:Cngb3 UTSW 4 19367778 missense probably damaging 1.00
R4719:Cngb3 UTSW 4 19309562 missense probably benign
R4774:Cngb3 UTSW 4 19415713 missense possibly damaging 0.85
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4898:Cngb3 UTSW 4 19395926 missense probably benign 0.08
R5216:Cngb3 UTSW 4 19415729 missense possibly damaging 0.93
R5647:Cngb3 UTSW 4 19364266 missense possibly damaging 0.51
R5945:Cngb3 UTSW 4 19283579 missense probably null 0.00
R6586:Cngb3 UTSW 4 19280946 missense probably damaging 0.99
R6650:Cngb3 UTSW 4 19364168 missense probably damaging 1.00
R6651:Cngb3 UTSW 4 19375231 missense probably benign 0.01
R7070:Cngb3 UTSW 4 19425593 missense possibly damaging 0.78
R7316:Cngb3 UTSW 4 19425599 missense probably benign 0.16
R7371:Cngb3 UTSW 4 19425575 missense possibly damaging 0.69
R7554:Cngb3 UTSW 4 19461753 nonsense probably null
R7755:Cngb3 UTSW 4 19461684 missense probably benign 0.01
R8004:Cngb3 UTSW 4 19505273 missense possibly damaging 0.85
R8025:Cngb3 UTSW 4 19280960 missense possibly damaging 0.95
X0062:Cngb3 UTSW 4 19364189 missense possibly damaging 0.91
X0067:Cngb3 UTSW 4 19367753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATGGAATTTCTCTCCTGGGTG -3'
(R):5'- GTTGGCACTAAGTAGACTTTCATC -3'

Sequencing Primer
(F):5'- CTCTCCTGGGTGTAAATGACC -3'
(R):5'- CAAGACTTGCCTTGGATTATGGCTC -3'
Posted On2015-09-24